Labshake search
Citations for Takara Bio :
501 - 550 of 6359 citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... RNA (1 ng) was amplified using SMARTer library Ultra Low cDNA v4 kit (Takara Bio, Mountainview, CA). Sequencing cDNA libraries were preparing using a NexteraXT DNA library prep kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from 1 ng of input RNA using the SMART-Seq HT Kit (Takara 634455) at half reaction volume followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized with 1 μg of total RNA using the Prime ScriptTM RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA (1 μg) was reverse transcribed with the PrimeScript™RT Reagent Kit (Takara Bio Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated from 1 μg of RNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara). The mRNA quantifications of target genes were performed by real-time PCR using the SYBR GREEN MIX (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... the total RNA (1 µg) was reverse transcribed by PrimeScript RT reagent Kit with gDNA Eraser (Takara, China). The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed with 1 μg of total RNA using the PrimeScript™ RT Reagent Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: cDNA was generated from 1 μg of total RNA by using the PrimeScript RT Reagent Kit (Takara, Japan) in accordance with the manufacturer’s protocol as previously described [21] ...
-
Airway Gene-Expression Classifiers for Respiratory Syncytial Virus (RSV) Disease Severity in InfantsbioRxiv - Immunology 2020Quote: ... 1 ng of total RNA was amplified using the SMARter Ultra Low amplification kit (Clontech, Mountain View, CA) and libraries were constructed using the NexteraXT library kit (Illumina ...
-
bioRxiv - Genetics 2019Quote: RNA-seq libraries were prepared from 1 ng of total RNA using the SMART-Seq HT Kit (Takara) combined with Nextera XT kit (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized using 1 µg of RNA following manufacturers’ instruction (1st strand cDNA synthesis kit, Takara; 6110A). RT-PCR was performed using SapphireAmp® Fast PCR Master Mix (Takara ...
-
bioRxiv - Microbiology 2019Quote: ... the Advantage® 2 Polymerase Mix (Clontech Laboratories) was used ...
-
bioRxiv - Microbiology 2019Quote: ... Advantage 2 Polymerase (Takara Bio, Mountain View, CA), mM each dNTP ...
-
bioRxiv - Plant Biology 2021Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 μL Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2 µg/ml doxycycline (Clontech, 631311) for 3 days prior to electroporation and to induce Cas9 nickase expression ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of T7 Enzyme Mix (TaKaRa). This was adjusted to 30 μL with nuclease-free ddH2O before incubating the mixture at 42°C for 2 h ...
-
bioRxiv - Genomics 2019Quote: ... 2X Advantage 2 Polymerase Mix (50X, Clontech, 639206), and 1X Loading Reagent (20X ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ul recombinant RNase inhibitor (Takara, 2313B). Isolated nuclei were sorted on a MA900 Multi-Application Cell Sorter (Sony Biotechnology) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μl of cloning enhancer (Takara-bio Inc.) was added to 5 μl of PCR reaction volume to remove the original plasmid ...
-
bioRxiv - Plant Biology 2022Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech). Transformants were grown on minimal synthetic defined (SD ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PrimeSTAR GXL DNA polymerase (Takara), 200 uM of each dNTP ...
-
bioRxiv - Physiology 2022Quote: ... The rat IGF1 coding sequence was then inserted into the linearized scAAV-CMV plasmid using In-Fusion cloning (Takara Bio; Cat. No. 639650). The resulting plasmids for scAAV-CMV-GFP and scAAV-CMV-IGF1 were packaged using AAV2/9 serotype by Vector Biolabs (Malvern ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 g RNA was used to synthesize the cDNA using reverse transcription M-MLV (RNase-free) kits (TaKaRa, Japan). qRT-PCR was performed with SYBR green PCR master mix (ToYoBo ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA (1 μg) was converted to cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA). Quantitative PCR (qPCR ...