Labshake search
Citations for Takara Bio :
501 - 550 of 2048 citations for NK 1 Receptor Rabbit Polyclonal affinity purified biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs from 1 μg DNase-treated purified RNA were obtained using PrimeScriptTM RT Master Mix (#RR036A, TAKARA) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-nc82 (1:50; Developmental Studies Hybridoma Bank) and rabbit anti-RFP (1:1000; TaKaRa Bio USA, #632496) at room temperature with agitation for 2 days ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: 1:500 rabbit anti-dsRed (Clontech), 1:100 goat anti-CHAT (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: Antibodies used were as followed: rabbit anti-DsRed (1:1000, Clontech Laboratories, RRID: AB_10013483); chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit Living Colors anti-DsRed (used for mCherry, tdTomato; 1:1000; Takara Bio, 632496); goat anti-RFP (used for mCherry ...
-
bioRxiv - Neuroscience 2021Quote: ... The following primary antibodies and dilutions were used: 1:500 rabbit anti-dsRed (Clontech), 1:500 mouse anti-NEUN (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: Primary antibodies used in this study were rabbit anti-dsRed (Clontech, 632496, 1:200), mouse anti-GFAP (ZIRC ...
-
bioRxiv - Cell Biology 2020Quote: ... then transferred to drop of GFP polyclonal antibody (TaKaRa, Cat. No. 632592) at 1:50 for 1 h and subsequently in second antibody conjugated with 18-nm gold particles (Jackson ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... The clarified extract was loaded onto a column containing TALON Metal Affinity Resin (BD Clontech, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The supernatant was applied to a TALON® metal affinity resin column (Takara Bio, Mountain View, CA, USA), and the column was washed with 10 column volumes of wash buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatants from the samples were added to 0.5 ml of a Talon metal affinity resin (Clontech, USA) equilibrated with binding buffer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified fragments required to generate the chimeric receptor were combined with a linearized pCS2+ backbone and annealed using an In-Fusion kit (Takara Bio, 638947). The resulting plasmids were transformed into Top10 chemically competent cells ...
-
bioRxiv - Physiology 2024Quote: ... Tissues were then incubated in a primary antibody solution (1:500 chicken anti-GFP, abcam, and 1:500 rabbit anti-mCherry, Takara) for two days at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... DRGs were transferred to a primary antibody solution (1:500 chicken anti-GFP, abcam, and 1:500 rabbit anti-mCherry, Takara) overnight ...
-
bioRxiv - Genetics 2022Quote: ... ISH was performed using digoxigenin-labeled oligonucleotide lnc-WAL probe (TCAGCACTGTCATCATTACATT) (Takara, Japan) according to previous literature(Liu et al. ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Biophysics 2019Quote: ... purified using cobalt resin from Clontech Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Neuroscience 2020Quote: ... before addition of 4 mM imidazole and incubation on a rotor (111 RPM) with TALON metal affinity resin (Takara, Cat.# 635503 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cell lysate was centrifuged at 40,000 × g for 45 min at 4 °C and the supernatant was loaded onto a cobalt affinity column (Clontech). After washing the column with 20 bed volume of 20 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was clarified at 26,915 x g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Nsp15 was eluted from the resin with 250 mM imidazole ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was isolated by centrifugation at 160,000 g for 30 min and incubated with TALON superflow metal affinity resin (Clontech) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was clarified at 26,915 × g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Thrombin-TEV-Nsp15 variants were eluted with 250 mM imidazole and further purified by gel filtration on a Superdex-200 column (GE Healthcare ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant with the soluble His6-UppH was loaded on to a 3 ml TALON Metal Affinity Resin (Clontech) equilibrated in binding buffer (50 mM Na2HPO4 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatants were loaded onto a column containing TALON® Metal Affinity Resin (635501; Takara Bio, Inc., Shiga, Japan). The resins were washed with lysis buffer and the His-tagged proteins were eluted with elution buffer (20 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Biochemistry 2024Quote: ... The other 2A proteins were separated from the lysate using immobilized metal affinity chromatography with either TALON beads (Clontech) or chelating Sepharose beads charged with NiCl2 (Cytiva) ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with a mix of up to three primary antibodies simultaneously diluted in PBST with 1 % NDS overnight at room temperature with the following primary antibodies: rabbit anti-dsRed (1:1000; Clontech, AB_10013483), chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated with a GFP antiserum (rabbit, 1:1000, Life Technology, #A6455) or an mCherry antiserum (mouse, 1:1000, Clontech, #632543). Primary antisera were diluted in PBS with 2% NGS overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then incubated overnight at 4°C with the following primary antibodies diluted in PBS - 0.3% Triton X100 - 1% NGS: rabbit anti-ZsGreen (1/1000, Clontech, 632474, RRID:AB_2491179) or rabbit anti- DCX (1/2000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following antibodies were used: rabbit or rat anti-dsRed (1:200, Clontech 632496 or 5F8 1:400, Chromotek 5f8-100); chicken anti-GFP (1:800 ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-labeled PACSIN2 was prepared by subcloning PACSIN2 cDNA into pmCherry-C1 vector (Clontech), in which the GFP in pEGFP-C1 was replaced with mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... or IMPA1L 120nt fragment were labeled using Random Priming Labeling Kits (Takara or Roche) and [α−32P] dCTP ...
-
bioRxiv - Immunology 2023Quote: ... Probes (50 ng) were labeled with 32P using the Ladderman DNA labeling kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... 32P-labeled dsRNAs were synthesized using the in vitro T7 Transcription kit (Takara Bio) with [α-32P]-UTP (PerkinElmer ...
-
bioRxiv - Developmental Biology 2019Quote: To quantify EEC morphology score, chick anti-GFP (Aves GFP1010, 1:500 dilution) and rabbit anti-mcherry (TAKARA 632496, 1:250 dilution) antibodies were used in the fixed Tg(gata5:lifActin-EGFP);Tg(neurod1:TagRFP ...
-
bioRxiv - Biophysics 2021Quote: ... A cDNA coding for 128QHTT with C-terminal fusion to a FLAG-His affinity tag was cloned into the vector pTRE-tight-BI-AcGFP1 (Clontech) for expression of 128QHTT upon induction with Dox ...
-
bioRxiv - Biochemistry 2020Quote: ... After high speed centrifugation (40 000 x g/40 min/4 °C) the supernatant was loaded on to a gravity TALON metal affinity column (Takara), equilibrated and washed with 10 CV buffer A/20 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The precipitated material was removed by centrifugation and the soluble fraction was loaded onto a column (5 mL) containing Talon affinity resin (Clontech) equilibrated in buffer A ...
-
bioRxiv - Biochemistry 2022Quote: ... The induction of His-and GST-fusion proteins and their subsequent purification using TALON® Metal Affinity Resin (Clontech Laboratories) and Glutathione SepharoseTM 4 Fast Flow beads (GE Healthcare) ...