Labshake search
Citations for Takara Bio :
501 - 550 of 1964 citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pMSCV-GADD34-puro contains the human PPP1R15A (GADD34, NM_014330.5) gene subcloned into the NcoI/EcoRI sites of the retroviral vector pMSCV-puro (Clontech Laboratories, Mountain View, CA).
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer specificity and amplification efficiency for genes of interest were verified by performing reactions on a dilution series of human reference cDNA (Takara, cat# 636693). Gene expression relative to GAPDH and RPLP0 house-keeping genes was calculated in Microsoft Excel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli cells: Stellar competent cells (Takara Bio, Cat#636763), chemically competent DH5α cells or NEB 10-beta competent cells (NEB ...
-
bioRxiv - Cell Biology 2020Quote: HeLa Tet-Off cells and Tet-On cells (Clontech) were maintained in Eagle’s minimum essential medium (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: HEK293T cells and Lenti-X 293T cells (Takara, 632180) were cultured using a regular medium [Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: ... HEK 293T cells (RRID:CVCL_0063; Lenti-X 293T cells, Takara) were maintained in DMEM complete medium ...
-
bioRxiv - Cell Biology 2021Quote: A549 cells (purchased from JCRB cell bank, Japan (JCRB0076)) and Lenti-X 293T cells (Takara Bio, Japan) were cultured in high-glucose Dulbecco’s modified Eagle’s media (DMEM ...
-
bioRxiv - Cell Biology 2022Quote: For HEK293T transduction: HEK293T cells (LentiX 293T cell line, Takara) were transfected in 10 cm dishes with packaging plasmid psPAX2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TRIM27 cDNA was obtained in pENTR221 vectors from the UT Southwestern (UTSW) McDermott Center for Human Genetics and subcloned into pCMV-HA or pCMV-myc (Clontech, Mountain View, CA) between SalI and NotI restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Takara) and selected on LB-Ampicillin plates ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cells (TaKaRa) were transformed with these plasmids for amplification and DNA storage ...
-
bioRxiv - Genetics 2022Quote: ... StellarTM cells (Takara) were transformed with the resulting plasmids ...
-
bioRxiv - Genetics 2022Quote: ... StellarTM cells (Takara) were transformed with the resulting plasmids ...
-
bioRxiv - Immunology 2021Quote: ... Stellar cells (Takara) were transformed with these polyclonal plasmid DNA mixtures and streaked to single colonies on LB agar plates supplemented with 100 μg/mL carbenicillin ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells (Clontech) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: Effector cells (NK92, T cells, and NK cells) were transduced with retroviral supernatants by centrifugation on RetroNectin (Takara) coated plates ...
-
bioRxiv - Cell Biology 2020Quote: HEK293T cells (632180, Lenti-X 293T cell line, Takara; RRID: CVCL_0063) for lentiviral packaging were expanded to 70-85 % confluency in DMEM Glutamax (+ 4.5 g/L D-Glucose ...
-
bioRxiv - Cell Biology 2022Quote: For primary neuron transduction: HEK293T cells (LentiX 293T cell line, Takara) for lentiviral packaging were expanded to 70-85% confluency in DMEM Glutamax (+4.5 g/L D-glucose ...
-
bioRxiv - Molecular Biology 2019Quote: HeLa Tet-off cells (HeLa TO cells) (Clontech, Palp Alto, CA) and A549 cells (kindly provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: HEK293T cells for lentiviral packaging (Lenti-X 293T cell line, Takara) were expanded to 70-85% confluency in DMEM Glutamax (+ 4.5g l−1 D-Glucose ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Physiology 2023Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line; Takara # 632273) in DMEM (SH30022.01 ...
-
bioRxiv - Physiology 2024Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line; Takara # 632273) in DMEM (SH30022.01 ...
-
bioRxiv - Cancer Biology 2021Quote: ... relative cell mass was assessed using WST-1 Cell Proliferation Reagent (Clontech) per manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were lysed with the xTractor Bacterial Cell Lysis Buffer (Clontech) and sonicated ...
-
bioRxiv - Physiology 2023Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line ...
-
bioRxiv - Physiology 2024Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line ...
-
bioRxiv - Physiology 2020Quote: ... coli Stellar cells (Clontech/Takara Bio USA Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... 293-LVX cells (Clontech) were transfected with pMSCV and pCl-Eco plasmids using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells (Stellar, TaKaRa) were used for all cloning steps and were grown in LB medium supplemented with antibiotics as required - ampicillin (100 μg/mL) ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa), grown in LB medium at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa). A synthetic version of the E ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (Takara Bio) and positive clones were identified via RFP selection before sequencing to confirm the cloning was successful.
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar cells (Takara) for non-R6K origin of replication-based vectors or PIR2 cells (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... coli cells (Takara Bio) and plasmid was prepared following standard protocols ...
-
bioRxiv - Microbiology 2022Quote: HEK 293T cells (Clontech) and its derivative ...
-
bioRxiv - Microbiology 2023Quote: AH109 yeast cells (Clontech) were used for yeast two-hybrid experiments ...