Labshake search
Citations for Takara Bio :
501 - 550 of 1397 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Genetics 2021Quote: ... The fragment length of PCR products was detected by 1.2% agarose gel electrophoresis using 5 μl of 100 bp DNA Ladder (TaKaRa, Japan) and gel stain (TransGen Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 ng/ml doxycycline (Clontech) was added 24 hours post-transfection ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U/µL Ex Taq polymerase (TaKaRa, Japan), 20 mg/mL BSA (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 U/mL RNase inhibitor (TAKARA)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 U/ml RNase inhibitor (TAKARA), Complete Protease Inhibitor EDTA-free in nuclease-free water) ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Flow-sorted cells were cultured in ex vivo GT media in a 96 well flat bottom plate coated with 33.3 ug/ml of Retronectin (Takara). The 62 hr protocol consisted of pre-stimulation in GT media (24 hr ...
-
bioRxiv - Biochemistry 2022Quote: ... The precipitated material was removed by centrifugation and the soluble fraction was loaded onto a column (5 mL) containing Talon affinity resin (Clontech) equilibrated in buffer A ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 5 μL of Premix Ex Taq (Takara, Dalian, China), and 1.5 μL of a mixture of probe (5’-TGCAC GTTGT GACAG TCGT-3’ ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 2.5 mM dNTPs (Takara Bio Inc.), 1 μL of 20 μM TruSeqUniv (Supplementary Table S7) ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 10× ExTaq buffer (Takara Bio Inc.), 5 μL of 2.5 mM dNTPs (Takara Bio Inc.) ...
-
bioRxiv - Genetics 2020Quote: ... 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa, Shiga, Japan), self-ligated by T4 ligase (TaKaRa ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 units of recombinant DNase I (TaKaRa, Kyoto, Japan), 200 units of RevertAid™ reverse transcriptase (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 U of Taq DNA polymerase (TaKaRa Bio) was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 5 µL of 2.5 mM dNTPs (Takara #4025), with the following thermal cycle condition ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Neuroscience 2019Quote: ... The remaining 5′ sequence was obtained by 5′-RACE on medaka brain poly(A)+ RNA using the Marathon cDNA Amplification Kit (Takara Bio, Shiga, Japan), essentially as described previously (Kawabata et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... the nucleus pellet was washed with 5 mL Nuclei Suspension Buffer (NSB; consisting of 1x PBS, 0.01% BSA and 0.1% RNAse inhibitor (Clontech, Catalog no.2313A)) ...
-
bioRxiv - Cell Biology 2021Quote: ... supernatant was removed and the nucleus pellet was washed with 5 ml nuclei suspension buffer (NSB; consisting of 1X PBS, 0.01% BSA and 0.1% RNase inhibitor (Clontech, cat. no. 2313A)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...