Labshake search
Citations for Takara Bio :
501 - 550 of 1027 citations for 7 Chloro 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant with the soluble His6-UppH was loaded on to a 3 ml TALON Metal Affinity Resin (Clontech) equilibrated in binding buffer (50 mM Na2HPO4 ...
-
bioRxiv - Cell Biology 2022Quote: ... then imaged after overnight expression and ∼3 hour incubation with 500 nM A/C heterodimerizer linker drug (Takara, 635055) or 100% ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Its male-specific exon was amplified using Advantage® 2 Polymerase Mix (TaKaRa), the gene-specific primer “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Genomics 2019Quote: ... Retroviruses were packed using the EcoPack 2-293 cells (Clontech, Mountain View, CA) and infections were performed as described12 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized by adding 2 μl of PrimeScriptTM RT reagent kit (TaKaRa) to 500μg of RNA samples in 8 μl of distilled water (DW ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR was carried out using 2× TB-Green premix (TaKaRa) on a LightCycler-480®II (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G, Clontech) or 2 μg of the pLenti-CMVtight-Hygro-DEST plasmid with each cDNA of interest ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was incubated for 2 hr with TALON metal affinity resin (Takara) pre-equilibrated with 50 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral titers were measured using Lenti-X GoStix (PT5185-2; Clontech, Takara Bio) following instructions provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral titers were measured using Lenti-X GoStix (PT5185-2; Clontech, Takara Bio) following instructions provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...