Labshake search
Citations for Takara Bio :
501 - 550 of 2365 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs], 0.625 mM each dNTP Mixture [TaKaRa] ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Genomics 2021Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountain View CA).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The 2-μg RNA sample was reverse transcribed using the PrimeScript™ RT Master Mix (Takara, Shiga, Japan). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Microbiology 2023Quote: HEp-2 cells were transduced with supernatants of Plat-GP cells cotransfected with pMDG60 and pRetroX-Tet3G (TaKaRa), selected with 4 mg/ml G418 (Wako) ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... 1 × GC buffer II and 1 U of LA Taq DNA polymerase (TaKaRa). The PCR cycles consisted of 95 °C for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... TEX12 (1-123) and SIX6OS1 (1-587) were cloned into pGADT7 vectors (Clontech). The Matchmaker™ Gold system (Clontech ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated twice in 1 ml of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... then in 1:25,000 or 1:100,000 rabbit anti DSRed (Takara Bio USA) in 10% NHS-TPBS ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 ng mL−1 or 25 ng mL−1 anhydrotetracycline (aTc, Clontech) and Aeromonas sp ...
-
bioRxiv - Physiology 2024Quote: ... (Cx43: 1:3000 custom-produced rabbit polyclonal; eGFP: 1:1000 mouse monoclonal (Clontech Laboratories Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... (1:1000 anti GAPDH) (1:1000 anti-TdTomato rabbit primary antibody #632496 from Takara).
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...