Labshake search
Citations for Takara Bio :
501 - 550 of 1794 citations for 6 Bromo 2 trifluoromethylimidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... adhaerens yeast 2-hybrid cDNA library was constructed using the Make Your Own “Mate & PlateTM” Library System (Takara Bio USA, Mountain View, CA), using whole animal total RNA extracted from approximately 30 animals using a Nucleospin RNA Plus Mini Kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2019Quote: ... This region was PCR amplified with DinoSL and KbrSRP-U6R1 primer set (sequences and Tm in Table 2) using the high fidelity PrimeSTAR HS DNA Polymerase (Takara, Kusatsu, Shiga Prefecture, Japan) at 94°C for 1 min ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...
-
bioRxiv - Microbiology 2021Quote: ... 6 μL of Reverse Transcriptase Buffer (5x First strand buffer (TaKaRa 639538), Betaine (Sigma B0300 ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Molecular Biology 2020Quote: ... EBs were transferred into coated 6-well plates (DEF-CS COAT, Takara) at a density of 30 EBs per well in IVD medium and harvested after 7 days.
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 6 ml Lenti-X Concentrator (Takara Bio; Cat. No. 631231), mixed thoroughly ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction mixtures mixed with a 6×loading buffer (Takara, Beijing, China) were loaded into the gel ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Immunology 2022Quote: ... or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara). RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Developmental Biology 2019Quote: ... New York)-coated 6-well plates in N2B27-containing NDiff 227 medium (Takara Bio Inc., Shiga, Japan) supplemented with 20 ng/mL activin A ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2024Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Genomics 2019Quote: ... and the expression of IFN-β and IL-6 were measured by quantitative PCR (TAKARA, RR820A). The sequences of the primers were listed in the Supplementary Table 4.
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Cell Biology 2019Quote: ... approximately 6 μg RNA was applied for 1st-strand cDNA synthesis using PrimeScriptTM RT Reagent Kit (TaKaRa, AK6003) with oligo (dT ...
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant (5 ml) was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and incubated for 4 h at 37°C ...