Labshake search
Citations for Takara Bio :
501 - 550 of 1455 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Genomics 2021Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountain View CA).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The 2-μg RNA sample was reverse transcribed using the PrimeScript™ RT Master Mix (Takara, Shiga, Japan). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Microbiology 2023Quote: HEp-2 cells were transduced with supernatants of Plat-GP cells cotransfected with pMDG60 and pRetroX-Tet3G (TaKaRa), selected with 4 mg/ml G418 (Wako) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 μL reaction mixtures comprising 10 μL of 2× SYBR (TaKaRa, Japan), 1 μL of cDNA ...
-
bioRxiv - Genetics 2024Quote: ... Yeast transformation was carried out using the Yeastmaker™ Yeast Transformation System 2 (Takara Bio Inc., cat. # 630439).
-
bioRxiv - Developmental Biology 2024Quote: ... Total RNA (2 μg) was reverse-transcribed into cDNA with random hexamers using the PrimeScript II reagent (TaKaRa). Human cDNA was purchased from Clontech ...
-
bioRxiv - Microbiology 2024Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Immunology 2024Quote: ... In-fusion assembly with the 2 fragments was performed using the In-fusion snap assembly kit by Takara Bio.
-
bioRxiv - Plant Biology 2024Quote: ... benthamiana leaves at 2 days post-agroinfiltration (dpa) using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: The fusion PCR reaction system (50 μl) consisted of 25 μl of 2 PrimeSTARMax Premix (TaKaRa, Dalian, China), 3 μl of 10 mM sgRNA-F ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated with 100ug/mL hygromycin B (Takara bio 631309). Cells were exposed to 100ug/mL hygromycin B for 8 days ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...