Labshake search
Citations for Takara Bio :
501 - 550 of 1832 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with siRNA-NPM1 39 or siRNA-HA (5’-CGC UUA UCC UUA UGA CGU A [dT] [dT]-3’) using the Xfect™ RNA transfection reagent (Takara Bio Inc., Shiga, Japan) following the manufacturer’s standard instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using each of the following 4 restriction enzymes: HaeIII or Hha I or Rsa I or Alu I (10 units, Takara Bio Co. Ltd. Shiga, Japan) in buffer solution (10xLow salt buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Bioengineering 2024Quote: ... to a final concentration of 5 µg/mL and 2 µg/mL doxycycline (631311, Takara Bio USA, Inc., Mountain View, CA, USA) for the first 7 days after seeding ...
-
bioRxiv - Microbiology 2020Quote: ... thlaspeos tissue was resuspended in 9 ml protoplasting buffer supplemented with 10 mg/ml Yatalase (Takara Bio, Kusatsu, Japan) and 20 mg/ml Glucanex (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Microbiology 2024Quote: ... with the One Step PrimeScript™ RT-PCR Kit (Takara Bio, RR064A). The following primers targeting a 244-base amplicon of the IAV M segment were used:
-
bioRxiv - Plant Biology 2024Quote: The Gold Yeast One-Hybrid Library Screening System (#630491; Takara, Shiga, Japan) was used for screening RSRE motif binding proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Cell Biology 2021Quote: ... JL-8 anti-GFP monoclonal antibody (TaKaRa, catalog # 632381, lot # A8034133) at 1:2,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-CHS (sc-12620 ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Genomics 2022Quote: ... 16 µL 100x DAPI and 8 µL ICELL8 Second Diluent (Takara) were added and incubated 10 minutes at RT ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-GFP clone JL-8 (Takara Bio Cat# 632380, RRID:AB_10013427), rabbit anti-FLAG clone D6W5B (Cell Signaling Technology Cat# 14793 ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-HY5 (Oravecz et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Molecular Biology 2022Quote: ... GFP expression was verified using immunoblotting using GFP (JL-8-Clontech) and α-tubulin (CP06 Calbiochem ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP expression was verified using immunoblotting using GFP (JL-8, Clontech) and α-tubulin (CP06 ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP was detected using an anti-GFP antibody (Clontech, JL-8) at a 1:1000 dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... The GFP antibody was purchased from Clontech (clone JL-8, 632380) and used at 1:2000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal GFP (JL-8, 632381, 1:2000 for immunoblotting, Clontech); Alexa Fluor-488- ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Microbiology 2024Quote: ... encoding region at the 3’ terminus of a putative linearized ambi-like virus was done following the protocol of the SMARTer® RACE 5’/3’ Kit (Takara Bio USA, Mountain View, CA, USA), employing a specific primer designed by Primer3-2.3.7 under Geneious (Supplemental Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Plant Biology 2020Quote: ... The BrSRK-9 CDS fragment was introduced into the KpnI site of pMYC290 by InFusion cloning (TAKARA Bio, Shiga, Japan). Fragments of CDS of the BrSRK S domain and transmembrane domain were amplified by PCR using the first-strand cDNA synthesized from stigma RNA (template ...
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... 9, 11, 13, 20, or 45 (SERF2, C9orf16, C19orf53, C11orf58, BEX3, or SERBP1 respectively) was inserted into pCold I (Takara), together with the client protein ...
-
bioRxiv - Plant Biology 2021Quote: ... fragments containing a stop codon were recombined into Gateway-compatible versions of the GAL4 DNA BD vector pGBT-9 and the activation domain vector pGAD424 (Clontech) using L/R-clonase (ThermoFisher) ...
-
bioRxiv - Plant Biology 2022Quote: ... fragments were recombined into GW versions of the GAL4 DNA-binding domain vector pGBT-9 and the activation domain vector pGAD424 (Clontech). Oligonucleotides used for cloning are listed in Supplementary Table S3.
-
bioRxiv - Genomics 2022Quote: ... Npm1/Flt3-ITD/Cas 9 DM murine AML cells were lentivirally-transduced using a Retronectin-transduction protocol (T100A; Takara Bio) with pHKO9 containing guide RNAs complementary to murine BAF complex members (Smarcb1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Confluent HEK293 cells were transfected using a mixture of 50 μl of Opti-MEM I containing a total of 0.9 μg of cDNA constructs encoding hGluN1/hGluN2 subunits and GFP (for identification of successfully transfected cells; pQBI 25, Takara) in a 1:1:1 ratio ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using One Step SYBR PrimeScript RT-PCR kit (Takara Bio) on a 7900HT real-time system (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... utilizing the PrimeScript™ One-Step RT-PCR kit (Takara Bio, Shiga, Japan). PCR products were then separated and visualized by agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized using the one-step PrimeScript RT-PCR Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... A One Step SYBR® PrimeScript™ qPCR kit (TaKaRa Bio, Otsu, Japan) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...