Labshake search
Citations for Takara Bio :
451 - 500 of 1146 citations for Recombinant Human Fms related Tyrosine Kinase 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA-seq library was prepared using the SMARTer Stranded Total RNA Sample Prep kit - HI Mammalian (Takara Bio Inc, Shiga, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified and ligated into the pET15b vector with a C-terminal His tag to create plasmid pET-AdpA by using the ClonExpress™ II One Step Cloning Kit (TaKaRa). The plasmid was transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was used for library preparation with the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... an MBP-tag and a TEV protease recognition site (His-MBP-TEV) by Infusion® HD Cloning kit (Takara Bio, USA). The fidelity of the constructs was confirmed by gel electrophoresis and sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... genes were cloned into a His-SUMO fusion protein expression vector (Kim et al, 2018) using an In-Fusion Cloning Kit (639648, Takara Bio). The glycine-arginine-proline (GRP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Neuroscience 2020Quote: ... this was followed by a second screening using the SD quadruple dropout (Leu−, Trp−, Ade−, and His−) selective medium (Clontech Takara Bio). After the elimination of duplicates containing the same AD/library plasmid via yeast-colony PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... suspensions of the transformants were spotted onto SD plates with dropout supplements: Leu/-Trp (cat #630417) or -Ade/-His/-Leu/-Trp (cat #630428) (Takara Bio). The strains used in this assay are listed in Table S1.
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... were run onto 8% SDS- polyacrylamide gels that were transferred to nitrocellulose membranes which were reacted with α-His tag antibody (#631212, Clontech). Quantitation of band intensities was done with ImageLab software (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... the amplified fragment was incorporated into the Bam HI site of pHSG396 using the In-Fusion HD cloning kit (TAKARA, Japan), resulting in the generation of pHSG396-ptrA.
-
bioRxiv - Cell Biology 2023Quote: ... suspensions of the transformants (1.0×106 cells) were spotted onto SD plate media with dropout supplements,-Leu/-Trp or-Ade/-His/-Leu/-Trp (cat #630428) (Takara Bio), and incubated at 30°C for 3 days.
-
bioRxiv - Molecular Biology 2024Quote: 900 ng of total RNA isolated from HUVEC was used as input for SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... fused with the SYFP2 coding region using recombinant PCR and cloned into pMSCV-Thy-IRES 1.1 vector (Clontech) using EcoRI/XhoI and ClaI restriction sites.
-
bioRxiv - Microbiology 2020Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant yeast strain was confirmed by PCR conducted with Matchmaker™ Insert Check PCR Mix (TAKARA, Japan). The full length of SlBES1.8 coding sequence was cloned into pGADT7 plasmid and subsequently transformed into the recombinant yeast strain ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Immunology 2020Quote: ... Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: Lysis plates were prepared by dispensing 0.4 µL lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Cells were lysed using Takara Bio Single Cell Lysis Buffer containing a recombinant RNase inhibitor (Takara Bio Inc.) then snap frozen ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Genomics 2021Quote: ... tissue or cells were placed in 2mL of EZ lysis buffer containing Recombinant RNase Inhibitor (Takara Bio 2313A), dounced 24 times with pestle A ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using the hot phenol method and treated with recombinant DNase I (Takara, cat# 2270A) in the presence of RNasin Plus (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Immunology 2023Quote: ... 0.6% NP-40 and freshly added 1mM DTT) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B) and incubated for 5 minutes on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: Human CaMKII-α (Uniprot_ID: Q9UQM7) and human CaMKII-β (Uniprot_ID: Q13554) were cloned into the pEGFP-C1 vector backbone (Clontech, Mountain View, CA), after modifying the vector to contain a biotinylation sequence (Avitag ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...