Labshake search
Citations for Takara Bio :
451 - 500 of 4961 citations for Rat Activity Dependent Neuroprotector Homeobox Protein ADNP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... The Capturem EV isolation mini kit (Takara) was used following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... CDNA was generated with PrimeScript kit (Takara). SYBR Green SuperMix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or In-Fusion HD Cloning Kit (TaKaRa). The GFP-fused full-length NCAN-expressing plasmid was constructed by inserting the fragment encoding GFP amplified from the pCAG-GFP vector into the central region of NCAN (corresponding to Val641 to Leu644) ...
-
bioRxiv - Plant Biology 2024Quote: ... using Yeastmaker™ Yeast Transformation kit (Clontech), and transformants were selected on double dropout medium SD/-Leu/-Trp at 30°C for three-days ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... using CalPhosTM mammalian transfection kit (Clontech #631312) and incubated for 16 hours ...
-
bioRxiv - Microbiology 2024Quote: ... In- Fusion HD Cloning Kit (Clontech 639649), and XL10-Gold Ultracompetent E ...
-
bioRxiv - Microbiology 2024Quote: ... using the Great EscAPe SeAP kit (Takara).
-
bioRxiv - Microbiology 2024Quote: ... using the Great EscAPe SeAP kit (Takara). T test was used to determine that only samples transfected with Rta induced significant viral reactivation (p<0.05 compared to Vec) ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were harvested for RNA extraction using RNeasy Plus Mini Kit (Qiagene) or NucleoSpin RNA Plus Kit (Takara). RNA concentration was measured by nanodrop and 500ng to 1000ng total RNAs were used for reverse transcription in 10 ul reaction volume by High-Capacity RNA-to-cDNA kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription (RT) was then initiated with the cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit; Takara) using the random hexamers option ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was converted to cDNA with the PrimeScript™ RT reagent Kit Prime Script TMRT reagent Kit (Takara, Japan), and the cDNA was analyzed by qRT-PCR using TB Green® Premix Ex TaqTM II (Takara ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... library preparation was performed using the SMARTER Stranded Total RNA Seq kit v2-Pico Input Mammalian kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was isolated (HiPure Plant RNA MIni Kit, Magen) and reverse transcribed (The PrimeScript® RT reagent Kit, Takara). Two pairs of primers (5′-GGCAAGAATCATCACGACCAG-3′ and 5′-GTATGCCATGAGGTCGTCCAC-3′ ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from wing discs of individual silkworms at the wandering stage using the MicroElute Total RNA Kit (OMEGA) and reverse transcription was performed using the PrimeScript RT reagent Kit (Takara). qRT-PCR experiments were performed using Hieff SYBR Green Master Mix (YEASEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining DNA was removed using the TURBO DNA-free kit (Thermo-Scientific) and cDNA generated using the PrimeScript cDNA synthesis kit (Takara). qRT-PCR reactions were set up according to the manufacturer’s instructions (Alkali Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared using the SMART-Seq v3 Ultra Low RNA Input Kit for Sequencing and the Low Library Prep Kit v1 from Clontech. For the an3 RNAseq experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cDNAs were produced using BioRad Reverse Transcription Kit (iScriptTM Reverse Transcription Supermix) or the PrimeScript RT reagent kit (RR037A, TaKaRa). cDNAs from HEK and THP89 cells were quantified by quantitative PCR using Bio Rad’s SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA with RIN > 7 was prepared for sequencing using the RNAseq Ovation V2 kit (Nugen) or Smart-seq 4 low-abundance RNA kit (Takara) and sequenced on the Illumina HiSeq 4000 or Novaseq 2 platform in collaboration with Oxford Genomics Centre.
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and indexing were performed as previously described using the Qiagen AllPrep DNA/RNA Micro Kit and the SMARTer Stranded Total RNA-Seq Kit v2 (Takara) (46 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Directional libraries were prepared using the Smarter Stranded Total RNA-Seq kit-Pico Input Mammalian kit following the manufacturer’s instructions (Clontech, 635005). The quality of all libraries was verified with the DNA-1000 kit (Agilent ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA synthesis and library preparation was performed using the SMART-Seq v4 Ultra Low Input RNA Kit and Low Input Library Prep Kit v2 (Clontech), respectively ...