Labshake search
Citations for Takara Bio :
451 - 500 of 808 citations for Rabbit Anti Sheep IgG H+L Alkaline Phosphatase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... MBL) and HRP-labeled IgG detector (1/5,000 dilution from the product, Western BLoT Rapid Detect v2.0, Takara Bio) were used as primary and secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit αdsRed (1:500, #632496, ClonTech, Mountain View, CA, USA) in blocking solution ...
-
bioRxiv - Developmental Biology 2022Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...
-
bioRxiv - Systems Biology 2022Quote: ... rabbit dsRed (1:500, Clonetech Takara 632496 to detect Tomato protein); mouse βTubulin (1:600 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... Quantitative PCR was alternatively performed for the cDNA using the SYBR® Premix Ex Taq™ (Tli RNase H Plus) (TAKARA-Clontech) using a QuantStudio5 system (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2022Quote: ... Quantitative PCR was alternatively performed for the cDNA using the SYBR® Premix Ex Taq™ (Tli RNase H Plus) (TAKARA-Clontech) using a QuantStudio5 system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were induced by 1 mM IPTG at 16°C for 20 h, then purified by a GST-tag Protein Purification Kit (Beyotime, Shanghai, China) or His TALON Purification Kit (Takara, Beijing, China). Corresponding primers are listed in Supplemental Table S2.
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was alternatively performed for the cDNA using the SYBR® Premix Ex Taq™ (Tli RNase H Plus) (TAKARA-Clontech) using a QuantStudio5 system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was alternatively performed for the cDNA using the SYBR® Premix Ex Taq™ (Tli RNase H Plus) (TAKARA-Clontech) using a QuantStudio5 system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... MA) and PrimeScript RT reagent kit with gDNA Eraser and SYBR Premix Ex Taq II (Tli RNase H Plus) (TaKaRa, Kusatsu, Japan) (Taniguchi and Yoshida ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was then used for qPCR analysis using the TB Green® Premix Ex Taq™ II (Ti RNase H Plus) (Cat. No. RR820A, Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The media was harvested 72 h post-transfection, filtered through a 0.45 μm filter (Millapore, Catalog #SLHVM33RS) and concentrated using LentiX (Takara Biosciences, Catalog #631232). Concentrated lentivirus was added to cells on day 2 of differentiation ...
-
bioRxiv - Immunology 2021Quote: Variable heavy chain and light chain sequences were PCR amplified from yeast plasmid DNA and cloned into CMV/R IgG expression vectors using InFusion (Takara). Plasmid DNA for mammalian expression of the His-tagged SARS-CoV-2 RBD in a pCAGGS vector was kindly provided by Dr ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA was synthesized from l μg of RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (catalogue No. RR047A, TaKaRa). qPCR was performed in triplicate in 20-μl reactions containing SYBR Premix Ex Taq II (catalogue No ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... After sonication and centrifugation (20 000 g, 1 h, 4 °C) the supernatant was mixed with Talon Metal Affinity Resin (Takara Bio USA, Inc.). After 1 hour incubation at 4 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Quantitative PCR (qPCR) reactions were prepared in triplicate using TB Green® Premix Ex Taq™ II (Tli RNase H Plus) (Takara, USA) with a modified protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral particles were collected at 36 and 72 h and then purified with 10% Lenti-X Concentrator® (Clontech, Mountain View, CA, USA). The virus copy number was determined by Q-PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: rabbit DsRed (1:3000, Takara Bio, 632496), rabbit β3-tubulin (1:3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... IHC was conducted using rabbit primary antibody dsRed (1:500, #632496, Takara) to label TdT+ cells ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated in primary antibody (Rabbit-DsRed, 1:1000 dilution, Takara) overnight at 4 ° C ...
-
bioRxiv - Molecular Biology 2024Quote: ... as well as the rabbit primary antibodies α-DsRed (Clontech, 632-496), α-CIRBP (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA (Clontech), anti-GST (Santa Cruz Biotechnology) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-STEM121 (Takara; Dilution 1:200 ...
-
bioRxiv - Immunology 2022Quote: ... added with RT-PCR master mix and IgG VH/VL primers per well and performed with RT-PCR following the one step RT-PCR kit protocol (Takara, RR057A). Then ...
-
bioRxiv - Genetics 2019Quote: ... About 1 μL of viral RNAs were used as template to synthesize cDNAs with PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Absolute quantitative real-time PCR assay was performed with SYBR green I (TOYOBO ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa (cTT20.1166, gift from Kara L. McKinley and Iain Cheeseman) and Lenti-X HEK293T cells (Takara Bio, used for lentivirus production) were cultured in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... were sub-cloned from pCMV-HA-BTN3A2-L and pCMV-HA-BTN3A2-S expression vectors into the pLVX-tight-puro vector (632162, Clontech, USA) (Supplementary Table S1) ...
-
bioRxiv - Plant Biology 2023Quote: ... were used to co-transform yeast strain AH109 and colonies carrying both vectors were selected on SD medium without tryptophan (-W) and leucine (-L) (TaKaRa 630317) at 28°C ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from the injected aphid nymphs 24 h post-injection using the Takara Nucleospin RNA Plus XS RNA extraction kit (Takara Bio Inc., Shiga, JP). For RNA extraction ...
-
bioRxiv - Physiology 2024Quote: ... (Cx43: 1:3000 custom-produced rabbit polyclonal; eGFP: 1:1000 mouse monoclonal (Clontech Laboratories Inc ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...