Labshake search
Citations for Takara Bio :
451 - 500 of 1926 citations for Primary Human Coronary Artery Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Physiology 2023Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line; Takara # 632273) in DMEM (SH30022.01 ...
-
bioRxiv - Physiology 2024Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line; Takara # 632273) in DMEM (SH30022.01 ...
-
bioRxiv - Cancer Biology 2021Quote: ... relative cell mass was assessed using WST-1 Cell Proliferation Reagent (Clontech) per manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... embryonic kidney cell line HEK293(ATCC CRL-1573) and 293GP cells (Clontech) were cultured in high glucose (5g/l ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were lysed with the xTractor Bacterial Cell Lysis Buffer (Clontech) and sonicated ...
-
bioRxiv - Physiology 2023Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line ...
-
bioRxiv - Physiology 2024Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were incubated in a blocking buffer containing the primary antibodies rabbit anti-mCherry (1:1500; cat. No. 632496, Takara Bio USA, Inc., Mountain View, CA, USA) and chicken anti-GFP (1:1500 ...
-
bioRxiv - Physiology 2020Quote: ... coli Stellar cells (Clontech/Takara Bio USA Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... 293-LVX cells (Clontech) were transfected with pMSCV and pCl-Eco plasmids using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells (Stellar, TaKaRa) were used for all cloning steps and were grown in LB medium supplemented with antibiotics as required - ampicillin (100 μg/mL) ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa), grown in LB medium at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa). A synthetic version of the E ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (Takara Bio) and positive clones were identified via RFP selection before sequencing to confirm the cloning was successful.
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar cells (Takara) for non-R6K origin of replication-based vectors or PIR2 cells (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... coli cells (Takara Bio) and plasmid was prepared following standard protocols ...
-
bioRxiv - Microbiology 2022Quote: HEK 293T cells (Clontech) and its derivative ...
-
bioRxiv - Genomics 2023Quote: ... coli cells (Takara Bioscience). Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2023Quote: AH109 yeast cells (Clontech) were used for yeast two-hybrid experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... HeLa TetOn3G cells (Takara) were co-transfected with the tet-L1/GLucAI donor plasmid (pBH201 ...
-
bioRxiv - Microbiology 2023Quote: ... coli Stellar cells (Clontech) and plated onto Luria Bertani agar supplemented with 25 µg/ml chloramphenicol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HEK293 cells (Takara 632180), C3H/10T1/2 Clone 8 (ATCC# CCL-226) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lenti-X cells (Clontech) were transfected with pMD2.G (addgene #12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... LX-293T cells (Takara) were seeded into 6-well plates and grown till 80% confluence was reached ...
-
bioRxiv - Genomics 2024Quote: ... Stellar competent cells (Takara) were used for transformation and downstream miniprep (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... into LentiX-cells (Takara) according to standard procedures ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LentiX cells (Takara 632180) were used to produce lentivirus ...
-
bioRxiv - Cell Biology 2021Quote: Hek293T cells for lentiviral packaging were purchased (Lenti-X 293T cell line, Takara) and expanded to 70-85% confluency in DMEM Glutamax (+ 4.5g/L D-Glucose ...
-
bioRxiv - Immunology 2020Quote: Transferrin over-expression or knockdown vectors were constructed and HEK 293T cells (Conservation Genetics CAS Kunming Cell Bank, China) and EcoPack™ 2–293 cells (Clontech, USA) were used to package lentiviruses and retroviruses ...
-
bioRxiv - Cancer Biology 2021Quote: ... Spodoptera frugiperda Sf21 cells (Clontech) were propagated in Grace’s medium (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... Spodoptera frugiperda Sf21 cells (Clontech) were propagated in Grace’s medium (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... into GP2-293 cells (Clontech). Virus was harvested and cleared via centrifugation at 48 hours post-transfection and infections were carried out in the presence of 10 μg/mL of polybrene (Sigma ...
-
bioRxiv - Microbiology 2022Quote: Lenti-X 293T cells (Clontech) and its derivative ...
-
bioRxiv - Microbiology 2022Quote: ... HeLa Tet-Off cells (Clontech) and HeLa Flp-In TREx GFP-Dcp1a cells (a generous gift from Dr ...
-
bioRxiv - Immunology 2022Quote: ... LentiX-293T cells (Takara Bio) and 293T cells were maintained in culture with Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 Tet-off cells (Clontech) were transfected with pTRE-TIGHT plasmids bearing the (de)optimized and WT sequences and incubated overnight at 37ºC ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lenti-X 293T cells (Clontech) were transfected at 90% confluence with JetPRIME (Polyplus ...
-
bioRxiv - Plant Biology 2020Quote: ... coli Stellar competent cells (Clontech). Inserts of all plasmids were sequenced from E ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293 Tet-ON cells (Clontech) were co-transfected with linearized pTRE-HTT128Q together with a plasmid expressing a hygromycin resistance gene ...
-
bioRxiv - Microbiology 2021Quote: Lenti-X 293T cells (Takara) were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia) ...
-
bioRxiv - Microbiology 2021Quote: ... Lenti-X 293T cells (Takara) were seeded in 10-cm dishes for 80% ...
-
bioRxiv - Cell Biology 2021Quote: Lenti-X HEK293T cells (Clontech) were grown at 37° ...
-
bioRxiv - Microbiology 2022Quote: ... HeLa Tet-Off cells (Clontech), Atg5 +/+ and -/- MEFs (119) ...