Labshake search
Citations for Takara Bio :
451 - 500 of 772 citations for GA binding protein alpha chain GABPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Anti-GFP (monoclonal antibody raised in mouse, Takara, USA, catalog # 632381) and anti-SEC12 (Bar-Peled and Raikhel ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Cell Biology 2024Quote: ... GFP was detected using an anti-GFP antibody (Clontech, JL-8) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibodies (anti-DsRed in rabbit 1:1000 (632496, Takara); anti-GFP in chicken 1:1000 (13970 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The membrane was incubated with an α-GFP primary antibody (Takara Bio cat# 632380 ...
-
bioRxiv - Plant Biology 2024Quote: ... The GFP antibody was purchased from Clontech (clone JL-8, 632380) and used at 1:2000 dilution ...
-
bioRxiv - Bioengineering 2024Quote: This experiment with a monoclonal antibody to Taq pol (Clontech, USA) and a DNA aptamer (Vector-Best ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: Cas9 (Takara, 632607; 1:150), MAP2 (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM benzamidine] and both His-tagged proteins were purified using TALON® Metal Affinity Resin from TAKARA (Clontech/Takarabio ...
-
bioRxiv - Neuroscience 2021Quote: ... Monoclonal GFP antibodies (clone JL-8; lot# A5033481-A) were from Clontech Takara Bio (San Jose ...
-
bioRxiv - Neuroscience 2021Quote: ... the primary antibody rabbit anti-dsRed (Takara Bio, Cat# 632496, 1:500) and the secondary antibody goat anti-rabbit ...
-
bioRxiv - Cell Biology 2020Quote: ... then transferred to drop of GFP polyclonal antibody (TaKaRa, Cat. No. 632592) at 1:50 for 1 h and subsequently in second antibody conjugated with 18-nm gold particles (Jackson ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DSRed antibody (Living Colours; Clontech; Cat# 632496, dilution 1:300), rabbit anti-red fluorescent protein (RFP ...
-
bioRxiv - Plant Biology 2022Quote: ... Blots were probed with anti-GFP monoclonal antibody JL-8 (632381, Clontech) diluted at 1/3000 in 1X PBS containing 0.1% Tween-20 and 5% non-fat milk ...
-
bioRxiv - Neuroscience 2022Quote: ... VTA slices were incubated with rabbit anti-dsRed polyclonal antibody (632496, Takara) as the primary antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: rabbit DsRed (1:3000, Takara Bio, 632496), rabbit β3-tubulin (1:3000 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated in primary antibody (Rabbit-DsRed, 1:1000 dilution, Takara) overnight at 4 ° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using antibodies against GFP (clone JL8, 63268; Clontech), Y15-phosphorylated Cdk1 (anti-Phospho-cdc2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sections were incubated overnight with mouse anti-STEM121 primary antibody (Takara, Y40410) and then developed with a DAB substrate kit (Cell Signaling ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a dilution 1:000 of the anti-DsRed antibody (Takara; 632496) for mCherry were used ...
-
bioRxiv - Neuroscience 2023Quote: ... IHC was conducted using rabbit primary antibody dsRed (1:500, #632496, Takara) to label TdT+ cells ...
-
bioRxiv - Biochemistry 2024Quote: ... Membrane was then incubated with 1:1000 mouse anti-His6 antibody (Clontech) for 15 mins ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rabbit anti-DsRed (Takara Bio, catalog #632496, 1:1000) and chicken anti-NeuN/FOX3 (EnCor ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 1:200 dilution and mouse monoclonal anti-mCherry antibody (Takara, 632543) in a 1:400 dilution at 4°C on rocker ...
-
bioRxiv - Molecular Biology 2024Quote: ... and probed with primary antibody in 4% skim milk or Immunobooster (Takara). After washing ...
-
bioRxiv - Microbiology 2024Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...