Labshake search
Citations for Takara Bio :
451 - 500 of 2131 citations for 6H Imidazo 4 5 1 ij quinolin 6 one 4 5 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Systems Biology 2022Quote: ... The blocked membrane was incubated overnight at 4 ℃ in primary antibodies: mouse polyclonal anti-Cas9 (Takara Bio, cat. no. 632607), mouse monoclonal anti-β-actin (8H10D10 ...
-
bioRxiv - Genomics 2019Quote: ... into individual wells of a 48-well plate (Brand) filled with 4 μl of a hypotonic lysis buffer containing 2 U/μL RNase inhibitor (Takara) and 0.2 % Triton-X-100 in Nuclease-free water ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-seq library was generated using the SMART-seq v.4 Ultra Low Input RNA Kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... Transient retroviral supernatants were produced as previously described.44 Activated NK cells were purified and transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... Same volume of samples were loaded on 4-16% gradient SDS-PAGE gels and analyzed by western blot analysis using EGFP (JL-8; Clontech), penta-HIS (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was annealed to primers by the addition of 4 µL 100 µM Random Hexamer Primers (TaKaRa, Mountain View, CA) and incubation at 65°C for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... The libraries for RNA sequencing were generated using SMART-Seq v.4 Ultra Low Input RNA (Takara Bio, cat. #634890) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Full length cDNA were generated from 4 ng of total RNA using Clontech SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Takara Bio Europe ...
-
bioRxiv - Biochemistry 2020Quote: ... After high speed centrifugation (40 000 x g/40 min/4 °C) the supernatant was loaded on to a gravity TALON metal affinity column (Takara), equilibrated and washed with 10 CV buffer A/20 mM imidazole ...
-
bioRxiv - Biochemistry 2020Quote: ... After high speed centrifugation (40 000 x g/40 min/4 °C) the supernatant was loaded on a HiTrap (GE) TALON Crude (Takara) metal affinity column ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA with RIN > 7 was prepared for sequencing using the RNAseq Ovation V2 kit (Nugen) or Smart-seq 4 low-abundance RNA kit (Takara) and sequenced on the Illumina HiSeq 4000 or Novaseq 2 platform in collaboration with Oxford Genomics Centre.
-
bioRxiv - Neuroscience 2020Quote: The cDNA libraries for used for sequencing of 4 total RNA samples were synthesized using a SMART-Seq Ultra Low Input RNA kit (Takara) in the OHSU Massively Parallel Sequencing Shared Resource Core Facility ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... 20μl cDNA solution per hemibrain was synthesised from 4-5g RNA using RNA-to-cDNA EcoDry Premix with random primers (Clontech), and was diluted 50-fold with distilled water.
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Microbiology 2020Quote: ... Different amounts of total RNA (4, 16, 32, or 40 ng) were used for first strand synthesis using SmartScribe RT (Clontech) and Oligo(dT)23 VN primer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara) using a quarter of the reagent volumes recommended by the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... Libraries from 4-cell embryos were also prepared using 18-30 nt gel purified RNA using the SMARTer smRNA-Seq Kit (Clontech) and NEXTflex-Small-RNA-Seq (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized pUCHCPV-20-4 was used as a template for in vitro transcription by T7 RNA polymerase (TaKaRa, Dalian, China) to generate chimeric HDAC11-S4 RNA 4 ...
-
bioRxiv - Immunology 2023Quote: ... The RT reaction mixture was prepared on ice and contained (per sample): 4 µL SmartScribe 1st Strand 5X buffer (Takara), 2 µL 100 µM DTT (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... transferred membranes were hybridized overnight at 4 °C with the following primary antibodies: anti-GFP (Takara Bio Cat# 632381, RRID:AB_2313808) (1/5000) ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reaction was prepared using gene-specific primers (20µM, Eurofins, primer sequences in Suppl. Table 4) and PrimeSTAR® Max DNA Polymerase (Takara) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Neuroscience 2024Quote: ... and re-plated at a concentration of 2.5×105 cells/cm2 onto plates coated with 4 μg/mL iMatrix-511 (Takara Bio) in N2B27 medium supplemented with 10 μg/mL BDNF and 10 µg/mL Rock Inhibitor Y-27632 ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Microbiology 2024Quote: ... the dish was split into two 1-ml Petri dishes and one was treated with rapalog (250 nM, Clontech) for 4 hours to induce the knock-sideway while the other served as control.
-
bioRxiv - Genomics 2022Quote: ... Total RNA from SARS-CoV-2 infected lung or trachea was subjected to one-step real-time reverse transcription PCR using One-step PrimeScript RT-PCR kit (Takara, RR064B). Multiplex PCR was performed to detect SARS-CoV-2 nucleocapsid gene and mouse Actb gene ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from 4-week-old seedlings of Chinese wildrye treated with 100 mM Na2CO3 using RNAiso plus (TaKaRa, Japan) according to the instruction manual ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR product was gel-purified and 400 ng of the purified product were used in a random priming reaction containing: 4 Units Klenow fragment (TAKARA, Japan), 5 μl 10x Klenow reaction buffer ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Immunology 2021Quote: ... First strand cDNA synthesis was performed with 4 μg of total RNA per reaction using PrimeScript™ II 1st Strand cDNA Synthesis Kit and oligo-dT primer (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA libraries were synthesized with 4 ng of total RNA input to the Clontech SMARTer smRNA-seq kit (Takara Bio 635034) using the manufacturer’s suggested protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then aspirated the cell with as little buffer as possible and blew it into 4μl lysis buffer [4 units of Recombinant RNase Inhibitor (Takara, Cat.No.2313), 2.5μM poly(T)30VN primer (Sangon) ...