Labshake search
Citations for Takara Bio :
451 - 500 of 2004 citations for 6 Pteridinepropanoic acid 2 4 diamino α 4 methoxycarbonyl phenyl α 2 propyn 1 yl methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from 4-week-old seedlings of Chinese wildrye treated with 100 mM Na2CO3 using RNAiso plus (TaKaRa, Japan) according to the instruction manual ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR product was gel-purified and 400 ng of the purified product were used in a random priming reaction containing: 4 Units Klenow fragment (TAKARA, Japan), 5 μl 10x Klenow reaction buffer ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Immunology 2021Quote: ... First strand cDNA synthesis was performed with 4 μg of total RNA per reaction using PrimeScript™ II 1st Strand cDNA Synthesis Kit and oligo-dT primer (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA libraries were synthesized with 4 ng of total RNA input to the Clontech SMARTer smRNA-seq kit (Takara Bio 635034) using the manufacturer’s suggested protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then aspirated the cell with as little buffer as possible and blew it into 4μl lysis buffer [4 units of Recombinant RNase Inhibitor (Takara, Cat.No.2313), 2.5μM poly(T)30VN primer (Sangon) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Co-IPs were carried out by incubating the samples with 30 μL of protein A agarose bead slurry for 4h at 4°C in a rotating wheel and with anti-mCherry (Takara 632496) of 1:1000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 or StNPR3/4 cds) construct combinations were transformed into the Y2H Gold strain using the Matchmaker Gold Yeast Two-Hybrid System (Clontech, USA) and the transformants selected on control SD media without Leu and Trp (-L-W) ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were centrifuged at 16,000 RCF for 5 min at 4°C and the supernatant was reserved for DNA clean-up using NucleoSpin® Gel and PCR Clean-Up (740609, Takara) based on manufacture instructions or ethanol precipitation.
-
bioRxiv - Microbiology 2023Quote: ... 293T cells were cotransfected with 2.4 μg of proviral DNA construct and 0.6 μg of VSV-G expression vector using TransIT-LT1 reagent (Takara, Cat# MIR2306) into 293T cells (3 × 106) ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were fixed with ice-cold 4 % paraformaldehyde for 20 min and stained with rabbit anti-dsRed antibody (Takara Bio) and Alexa fluor 568-conjugated anti-rabbit secondary antibody to identify cells expressing mApple-tagged Myo6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...