Labshake search
Citations for Takara Bio :
451 - 500 of 1763 citations for 6 Octen 1 ol 3 7 dimethyl 1 formate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit α-RFP (1:500; Clontech, cat# 632496, RRID:AB_10013483); mouse α-lacZ antibody (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were induced with 1 µM rapalog (AP21967, Takara) for 45 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 10 U ml−1 of HRV- 3C protease (Takara) were added to the Ni-NTA eluted protein to remove the oligohistidine- GST-tag during dialysis against 3 L of dialysis buffer I (25 mM Tris-HCl ...
-
bioRxiv - Genomics 2020Quote: ... was cloned into modified pCold-1 (Takara Bio Inc.), in which the factor Xa cleavage site was replaced with tobacco etch virus (TEV ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: 1 part of Lenti-X™ concentrator (TaKaRa; 631232) was first mixed with 3 parts of supernatant and incubated at 4 °C overnight for lentivirus precipitation ...
-
bioRxiv - Genomics 2019Quote: ... once with 50 μL 1× First-Strand Buffer (Clontech) and resuspended in 38 μL reverse transcriptase solution (1× First-Strand Buffer (Clontech) ...
-
bioRxiv - Genetics 2019Quote: ... using the pEGFP-1 plasmid (Clontech, Mountain View, CA) as template ...
-
bioRxiv - Bioengineering 2019Quote: ... coli DH5α (TaKaRa, hsdR, recA, thi-1, relA1, gyrA96). E ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-DsRed (1:500, 632496, Takara Bio).
-
bioRxiv - Microbiology 2020Quote: ... Ab anti-GFP (Clontech #632592, WB dilution 1:1000), Ab Beta Actin HRP conjugated (Abcam ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit poly-clonal anti-GFP (1/800, 632592, Clontech), anti-Myosin heavy chain (1/10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... stained with anti-GFP antibody (1/800, 632592, Clontech) and biotinylated anti-rabbit IgG (1/200 ...
-
bioRxiv - Neuroscience 2020Quote: ... and dsRed (1:600, Takara Bio, 632496; RRID: AB_10013483) was performed on adult brain sections of quadruple transgenic zebrafish ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with α-MYC (mouse, 1:500, Clontech #631206) in 4 % BSA-PBS for 60 min at room temperature to stain surface expressed GluK2 ...
-
bioRxiv - Neuroscience 2021Quote: - 1/1000 Rabbit α-dsRed (Takara, Living Colors 632496)
-
bioRxiv - Biochemistry 2020Quote: ... according to the Yeast Protocols Handbook (PT3024-1, Clontech).
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-dsRed dilution 1:100 (IF) (Clontech, 632496); mouse anti-M6PR dilution 1:100 (IF ...
-
bioRxiv - Physiology 2021Quote: ... 1 mL of Fruit-mate (Takara, catalog no.: 9192) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-GFP JL-8 (1:1000, Clontech 632380), polyclonal rabbit anti-RP2 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... we used 1 μL of Extaq enzyme from Takara on genomic DNA (20 μg ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 U µl−1 recombinant RNase inhibitor (Clontech)) using a Wheaton Dounce tissue grinder (15 strokes with the loose pestle) ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL of T4 DNA ligase (Takara Bio Inc.) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-DSRed (targeting mCherry; 1:2000; Clontech), washed ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μL (1 mU) of Pfu PGAP (TaKaRa) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... 1× Universal Primer Mix (first PCR, Clontech Laboratories, Inc.) or 1× Nested Universal Primer (secondary PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of PrimeScript One Step Enzyme Mix (TaKaRa), 10 μL of 2× One Step RT-PCR buffer (TaKaRa) ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit-anti-RFP (1:500, Clontech 600-401-379); mouse-anti-24B10 (Zipursky et al. ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 U μl−1 PrimeScript Reverse Transcriptase (Takara) at 48 °C for 30 min ...
-
Activity-regulated growth of motoneurons at the neuromuscular junction is mediated by NADPH oxidasesbioRxiv - Neuroscience 2022Quote: ... Rabbit-anti-dsRed (1:1000) (ClonTech Cat. No. 632496), Mouse nc82 (Bruchpilot ...
-
bioRxiv - Pathology 2022Quote: ... Primary antibodies: rabbit anti-DsRed express (Clontech, 1:250) and goat anti-HRP (Jackson Lab ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 U/µL TaKaRa RNAse inhibitor (Takara, Shiga, Japan) was added before each experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 U/μL ribonuclease inhibitor (porcine liver) (TaKaRa Bio), 0.25 U/μL AMV reverse transcriptase XL (TaKaRa Bio) ...
-
bioRxiv - Neuroscience 2023Quote: ... and mCherry (anti-dsRed polyclonal, 1:1000; Clontech, 632496). Sections were then washed in phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... anti GFP (mouse monoclonal, JL8, Clontech; WB: 1:6000), anti-human tubulin (mouse monoclonal ...
-
bioRxiv - Microbiology 2023Quote: Plasmids pGADT7 and pETDuet-1 were purchased from Clontech and Novagen respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DSred primary antibody 1:500 (Takara, 632496) which binds Td-tomato protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... monosodium salt (WST-1) (Takara BioInc, Clontech Laboratories, Inc.). 4 × 103 cells/ml was cultured in 5 replicates in 96-well plates ...