Labshake search
Citations for Takara Bio :
451 - 500 of 2390 citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 90 μl of RNase free water was added and then 2.5 μl of diluted sample was used for real-time RT-PCR according to the manufacturer’s protocol with One step TB green PrimeScript PLUS RT-PCR Kit (Takara, Cat# RR096A) and primers for Nucleocapsid (N ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to the target sequence on M ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Plant Biology 2020Quote: One µg of total RNA was used to generate cDNA with the SMARTer PCR cDNA Synthesis kit (Clontech, Mountain View, CA, USA). Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... LINC00662 (NR_027301) and ELK4 (NM_001973.4) were detected by One-Step SYBR PrimeScript RT-PCR Kit (Perfect Real Time; Takara Bio, Inc., Kusatsu, Japan). Relative expression values were calculated using the relative quantification (2−△△Ct ...
-
bioRxiv - Plant Biology 2020Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Immunology 2022Quote: ... The day before transduction, a non-tissue culture treated 24-well plate (Grener Bio one, #662102) was coated with retronectin (Takara Bio, #T100B) in PBS (7μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: The MDM4 coding sequence (NM_002393.5) was cloned into Lenti-X™ Tet-One™ Inducible Expression System (Takara Bio, cat. no. 631847). The resulting plasmid was then subject to whole-plasmid sequencing for verification ...
-
bioRxiv - Microbiology 2023Quote: ... levels were measured by a qRT-PCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A). The PCR protocol was 42°C for 5 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The expression of marker genes was detected by qRT-PCR using the One-step TB Green PrimeScriptTM RT-PCR kit II (Takara, Osaka, Japan). All genes were normalized against the level of an actin reference gene (Foo et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA copy numbers of each virus stock were measured via RT-qPCR assay with the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A) as described previously [12] ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Genomics 2024Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...