Labshake search
Citations for Takara Bio :
451 - 500 of 1949 citations for 6 Boc 1 oxa 6 azaspiro 3.3 heptan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Physiology 2022Quote: ... Kidney fibrosis was induced by one daily intraperitoneal injection of 0.2 μg/g body weight for 5 days of the chemical AP20187 (Takara Bio Inc. Kusatsu, Japan), in 8-10 weeks-old male transgenic mice ...
-
bioRxiv - Immunology 2022Quote: ... Real-time RT-PCR analyses for viral RNA copy number was carried out with One Step PrimeScript™ III RT-qPCR Mix (Takara, Cat# RR600B) and reactions were performed by using LightCycler® 96 System (Roche Diagnostics GmbH ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Molecular Biology 2020Quote: ... First-strand cDNA was synthesized with a PrimeScript™ RT synthesis kit with one-step genomic gDNA eraser kit according to instructions (TaKaRa, Tokyo, Japan). Gene-specific primer sets were designed based on the ORF ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 15 min and then harvested for quantification of INF α mRNA using the One-step SYBR Prime script RT-PCR kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... and real-time RT-PCR was performed by targeting the SARS-CoV-2 RdRp gene as follows: each 20 µl sample consisted of 12.5 µl One Step PrimeScript™ III RT-PCR Kit (Takara Bio, Shiga, Japan), 0.5 µM Sars-CoV-2 CRV forward primer (5’-TCACCTAATTTAGCATGGCCTCT-3’) ...
-
bioRxiv - Neuroscience 2023Quote: ... Each of the four pools was converted into one Illumina-barcode indexed sequencing library using the ThruPLEX DNA-Seq HV kit (Takara Bio Catalog# R400740), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was used for complementary DNA (cDNA) synthesis by PrimeScript first strand cDNA synthesis kit (TAKARA-Bio, Cat# 6110) using an oligo(dT ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: ... one containing Mu Mx1 and one containing the Tol2 transposase were transfected into DF1 cells at 50-70% confluency using Xfect transfection reagent (Takara Bio, San Jose, CA) at a 5:1 ratio respectively ...
-
bioRxiv - Microbiology 2021Quote: ... UK) containing the 27F/1492R primer set and MightyAmp DNA polymerase Ver.3 (Takara Bio). PCR was performed according to a previous report (Fujiyoshi et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... To ensure we had the full-length transcript we performed 3’RACE (SMARTer RACE Takara) using a forward primer 5’-GGAGCACAGACCAATGGAGC-3’.
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the SMARTer ICELL8 3 ‘DE Reagent Kit V2 (Takara Bio, Cat # 640167) from isolated nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Cell Biology 2022Quote: Yeast-two-hybrid analysis was performed with the MATCHMAKER GAL4 Two-Hybrid System 3 (Clontech) essentially as described (39) ...
-
bioRxiv - Microbiology 2020Quote: The putative 3’ UTR of FOXO3a was cloned into the dual luciferase reporter pSiCheck2 (Clontech) using the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... mouse DPPA3 cDNA was sub-cloned into a pGEX4T-3 plasmid using In-Fusion (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA-seq libraries for gene expression were constructed using Clontech SMARTer v.3 kit (Takara). Small RNA libraries were constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... to the 3’ end of the GFP at the PmeI site using InFusion Cloning (TaKaRa) and screened with PCR and restriction digests (Supplementary Table S8) ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...