Labshake search
Citations for Takara Bio :
451 - 500 of 4983 citations for 5 Hydroxytryptophan 5 HTP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
bioRxiv - Microbiology 2023Quote: ... as previously described (17): pcDNA3.1+-based plasmids used for ectopic expression and pRetroX-tight-Puro-based ones (Clontech, cat. PT3960-5) used here to generate stable cell lines expressing ISG20 upon induction with doxycycline (dox.) ...
-
bioRxiv - Cell Biology 2023Quote: ... the University of North Carolina at Chapel Hill) (43) and inserted back into pIZ-Msps-GFP digested with SspI(5’) and XhoI(3’) using Infusion ligation (Takara Bio) to create pIZ-Msps (RNAi-resistant)-GFP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VH and VL segments were ordered as gene blocks from Integrated DNA Technologies and were cloned into linearized CMV/R backbones with 5× In-Fusion HD Enzyme Premix (Takara Bio).
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Neuroscience 2021Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... Doxycycline-inducible NEK9 stable U2OS cell lines were generated through lentiviral transduction of parental U2OS cells stably carrying the pVLX-Tet-On-Advance vector (Clontech, PT3990-5). Briefly ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... We froze 5 μL of the supernatant in 45 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, Takara Bio Inc.) before analysis by polymerase chain reaction (PCR) ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Single colonies grown on selection plates were inoculated in 5 ml of SD-Leu-Trp overnight at 28 °C (ST0047, Takara Bio, USA). Saturated culture was then used to make serial dilutions of OD600 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 30 sec polymerase activation at 98 °C followed by 30 cycles of 15 sec denaturing at 98 °C and 5 min annealing and extension at 65 °C (or variable values in gradient mode) in Thermal Cycler Dice ® (Takara Bio). The PCR products in Pool 1 and 2 reactions for same clinical samples were combined and purified with 1X concentration of AmpureXP.
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and an extra 15 bp at the 3’ and 5’ ends allowing their insertion into the linearized NheI-PacI pUASt-5C plasmid using In-Fusion cloning strategy (Takara Bio USA, Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Physiology 2022Quote: ... Kidney fibrosis was induced by one daily intraperitoneal injection of 0.2 μg/g body weight for 5 days of the chemical AP20187 (Takara Bio Inc. Kusatsu, Japan), in 8-10 weeks-old male transgenic mice ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Genetics 2019Quote: 3000 quiescent satellite cells were lysed after FACS by sorting directly into a 0.2ml tube containing 1 μl SMART-Seq Reaction Buffer (95% SMART-Seq 10x lysis buffer containing 5% SMART-Seq RNAse Inhibitor, Takara Bioscience, Cat. 634890) in 8μl ddH20 ...
-
bioRxiv - Pathology 2020Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Plant Biology 2019Quote: ... 1.5 kb) was amplified with P1 and P2 primers (see Supplementary Table 1) from Col genomic DNA using PrimeStarMax (Takara Bio, Kusatsu, Japan) and inserted in HindIII-XbaI digested pGWB51131 by the SLiCE method32 to give p511G1pro ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was subjected to three freeze-thaw cycles at -80 °C and 37 °C and treated with 5 units of DNase I (TaKaRa Bio, Otsu, Japan) and 20 ng RNase (Nippon Gene ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The primary antibody was incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were then blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) mixed with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The chosen primary antibody was then incubated overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Cell Biology 2020Quote: ... the PLIN2 cDNA was inserted on the 5’ end of pME-tdTOMATO using In-Fusion HD Cloning Plus (Takara, Mountain View, USA, Catalog #638920). Gateway cloning using the Gateway LR Clonase Enzyme mix (Thermo Fisher ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...