Labshake search
Citations for Takara Bio :
451 - 500 of 5295 citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2023Quote: ... viral particles were concentrated 20-fold to 400Lμl using Lenti-X Concentrator (Clontech, #631231, Mountain View, CA), and 100Lμl of concentrated virus was used to infect cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was heat denatured and digested with 10-20 U of MazF enzyme (TakaRa, ref. 2415A) for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: anti-GFP (JL-8; 1:20, Clontech, Saint-Germain-en-Laye, France), anti-PHB1 (EP2803Y ...
-
bioRxiv - Genetics 2021Quote: ... and were routinely cultured on gelatin-coated plates in t2i/L media: NDiff (N2B27) (Takara #y40002) supplemented with titrated 2i (0.2μM PD0325901 ...
-
bioRxiv - Genetics 2020Quote: ... the plate was applied to a Thermal Cycler Dice® Real Time System II (TP900; TAKARA) with the following amplification conditions ...
-
bioRxiv - Immunology 2019Quote: Non-tissue culture treated 12-well plates were coated overnight at 4C with 1mL Retronectin (Takara) at 25ug/mL in PBS ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Immunology 2020Quote: ... the above plates were added with the RNase inhibitor and PrimeScript II Reverse Transcriptase (Takara, Japan) to a total volume of 10 μl ...
-
bioRxiv - Neuroscience 2023Quote: Each lysis plate well contained 4uL of lysis buffer (4U Recombinant RNase Inhibitor (Takara Bio 2313B), 0.05% Triton X-100 ...
-
bioRxiv - Immunology 2024Quote: ... The RNeasy kit and the cDNA Synthesis Kit (Takara, Cat#: 9767, RR047A) was used to extract total RNA and prepare cDNA following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: LATaq Kit (RR002B, TaKaRa) was used in nested PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Genomics 2022Quote: ... 20 individual bacterial colonies were separately picked from a dilution plating and miniprepped using Nucleospin Plasmid (Takara Bio), and the extracted plasmids were Sanger sequenced to verify the cloning quality of the library ...
-
bioRxiv - Immunology 2021Quote: ... Each 20 μL of PCR mixture contained 10μl of TB Green Premix Ex Taq (Tli RNaseH Plus, Takara) (2X) ...
-
bioRxiv - Cell Biology 2022Quote: ... First-strand cDNA was synthesized in a 20 μl of reaction volume using a random primer (TAKARA, Japan) and 1 μl reverse transcription enzyme M-MLV-RT (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR amplification was typically conducted with ~20 overlapping DNA base primers and the PrimeSTAR HS DNA Polymerase (Clontech) or the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific) ...
-
Effects of Sanhuang plaster on expression of MyD88, TRAF6, MIP-1β and IL-23 in rats infected by MRSAbioRxiv - Molecular Biology 2022Quote: ... Real-time fluorescence quantitative PCR kit and reverse transcription kit(TaKaRa Co., Ltd.); MyD88 Anti-body TRAF6 Anti-body MIP-1β Anti-body and IL-23 Anti-body (GeneTexCo. ...
-
bioRxiv - Biophysics 2020Quote: ... using a cDNA synthesis kit (PrimeScript 1st strand cDNA Synthesis Kit, Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used for purification and titration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used ...
-
bioRxiv - Immunology 2021Quote: ... 24-well non-tissue culture plate wells were pre-coated with RetroNectin® (Takara Bio USA, Inc.) according to manufacturer’s instructions and then day 10 cultured Tregs were added at 0.3 x 106 cells/well in 0.3mL of cell culture media ...
-
bioRxiv - Molecular Biology 2020Quote: Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2022Quote: ... In brief we sorted labeled T cells into 384 well plates (Armadillo) containing 3μl of Smart-seq3 lysis buffer (0.04μl RNAse inhibitor (40U/μl RRI, TaKaRa), 0.1% Triton X-100 ...
-
bioRxiv - Microbiology 2022Quote: ... treatment was used for cDNA library preparation using Make Your Own “Mate & Plate™” Library System (TaKaRa). All the procedures were followed according to the manual provided ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses corresponding to different CAR constructs were transduced into activated T cells in retronectin-coated plates (Takara). Cultures were allowed to expand for 10 days in their media supplemented with 300 IU ml-1 IL-2 ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Bioengineering 2020Quote: ... Transformed strains were grown at 30 °C on agar plates containing minimal SD base (Clontech, cat. 630411) and –His/–Trp/–Ura dropout supplement (Clontech ...
-
bioRxiv - Plant Biology 2021Quote: ... the cDNA library was prepared using the “mate and plate” library preparation system (Clontech, Mountain View, USA). The prepared library ...