Labshake search
Citations for Evrogen :
1 - 50 of 78 citations for Anti Selenoprotein N Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... This was incubated with the appropriate antibodies (anti-GFP polyclonal antibody and anti-tRFP antibody, Evrogen, reference # AB233) and revealed with Roche LumiLight ECL kit after incubation with secondary antibody.
-
bioRxiv - Plant Biology 2020Quote: ... an anti-TagRFP antibody (Evrogen) was added to the beads ...
-
bioRxiv - Microbiology 2021Quote: ... pTAG-BFP-N (Evrogen, FP172) was used.
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-tRFP primary antibodies (Evrogen, Russia) were used with Goat anti-rabbit IgG-peroxidase conjugate (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-Tag(CGY)FP (1:2000 in 0.5% milk TBST, 4°C o/n, Evrogen AB121). Blots were then incubated with IRDye 800/680 conjugated antibodies (1:10000 in 5% milk TBST ...
-
bioRxiv - Molecular Biology 2021Quote: ... or TagGFP2 (pTagGFP2-N vector, Evrogen) were used as controls for the crosstalk of the TagGFP2 signal into the red channel and the Katushka signal into the green channel ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-TagGFP2 antibody (Evrogen #AB121; 1:3000). HRP-conjugated secondary antibodies were purchased from The Jackson Laboratory.
-
bioRxiv - Cell Biology 2023Quote: ... with BFP from pTagBFP-N Vector (Evrogen) at EcoRI/XbaI) ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used rabbit polyclonal Anti-tRFP and Anti-TurboGFP(d) antibodies (Evrogen, Russia) diluted at 1:7000 ...
-
bioRxiv - Cell Biology 2019Quote: ... TagRFP fragment without start codon was obtained by PCR with TagRFP-woATG-F 5’-GT CGGTACCGTGTCTAAGGGCGAAGAGCTG-3’ n BFPX3-R 5’-GCGCTTAAGTTAATTAAGCTTGTGCCCCA-3’ primers and pTagRFP-N vector (Evrogen) as a DNA source ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and cloned into TagRFP-AS-N vector (Evrogen). The SsPrx03 and SsPrx03m1-TagRFP C-terminal fusion was then subcloned (LR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and vector pTurboGFP-N (Evrogen) were digested with XhoI and HindIII purified and ligated to generate pGADD34-TurboGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells expressing either Katushka (pTurboFP635-N vector, Evrogen) or TagGFP2 (pTagGFP2-N vector ...
-
bioRxiv - Biophysics 2024Quote: ... or an anti-KillerRed antibody (#AB961, Evrogen, Moscow, Russia) in CanGet signal immunoreaction enhancer solution 1 (TOYOBO ...
-
bioRxiv - Microbiology 2019Quote: ... the TagGFP2 sequence of the pTagGFP2-N vector (Evrogen) was amplified via PCR (5’-ATAAGAATTCCGGAATGAGCGGGGGCGAGGAG and 5’-CGGGGAATTCCATATGTTACCTGTACAGCTC primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Red fluorescent protein expression vector pTagRFP-N were from Evrogen, Moscow ...
-
bioRxiv - Developmental Biology 2022Quote: ... mKate2 was amplified from the pmKATE2-N plasmid from Evrogen introducing flanking B2 and BamHIXhoI-B3 sequences and cloned into pGEM-T Easy ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TagCFP DNA fragment was amplified from pTagCFP-N (Evrogen) by PCR with the primers 5′-GAAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATACCGGTCGCC ACCATGAGCG-3′ and 5′-CCGGAATTCCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATACCACAACTAGAATGCAGTG-3′ ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-Aub antibody (1:20) (Patil and Kai 2010) or mouse anti-mKate2 (Evrogen, 1:200) was added to the cleared lysate and incubated at 4°C for 2 h with rotation ...
-
bioRxiv - Pathology 2019Quote: ... The protein samples were detected with a polyclonal anti-tRFP antibody (Evrogen) for TagBFP ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway® TagRFP-AS-N entry clone (Evrogen). The PRX62-TagRFP fusion was subcloned (Gateway Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The fragment encoding tagRFP was PCR-amplified from pTagRFP-N (Evrogen). The fragments of ftsZ ...
-
bioRxiv - Microbiology 2020Quote: ... Chlamydiae were stained with polyclonal a rabbit anti-tRFP antibody (Evrogen, Cat. # 233), which recognized the RFP mKate protein ...
-
bioRxiv - Neuroscience 2019Quote: ... They were then incubated with primary antibodies, rat monoclonal anti-GFP (Nacalai Tesque, GF090R) at 1:2000 and rabbit polyclonal anti-tRFP (Evrogen, AB233) at 1:2000 ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were incubated overnight with rabbit anti-tagRFP (which recognise also tagBFP) or rabbit anti-tag(CGY)FP primary antibodies (both from Evrogen, Milan, Italy) at 1:5000 in PBST with 0.5% non-fat dry milk ...
-
bioRxiv - Cell Biology 2022Quote: ... and incubated with the antibody (mouse anti-GFP [Thermos Fisher Scientific, 3E6, 1:500] or mouse anti-mKate2 [Evrogen, AB233, 1:500]) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primary antibodies were used: anti-GFP in a titer of 1:8000 (AB011, Evrogen, Russia), anti-NCL in a titer of 1:7000 (#a300-711A ...
-
bioRxiv - Molecular Biology 2020Quote: ... mIBP83 fragment of pEX-A2-SBP-T plasmid was subcloned into pTagGFP2-N vector (Evrogen) by PCR with the primers
-
bioRxiv - Neuroscience 2020Quote: ... (ii) the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cytosolic expression was facilitated by expression of free Padron2 inserted into the TagRFP-N vector (Evrogen, Moscow, Russia) with enzymes AgeI and NotI ...
-
bioRxiv - Cell Biology 2022Quote: ... EB1-TagRFP was generated by PCR amplification from KAZUSA cDNA (NCBI AB463888) and inserted into pTagRFP-N (Evrogen). The shRNA target sequence was designed for protein knockdown using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... and in primary antibody (α-tRFP, [mKate antibody, Evrogen, AB233] ...
-
bioRxiv - Cell Biology 2020Quote: ... Input and bound fractions were subjected to SDS-PAGE followed by immunoblotting analysis with anti-TagRFP antibody (Evrogen, Moskau, Russia) and anti-GFP antibody (3H9 ...
-
bioRxiv - Cell Biology 2019Quote: ... VE-cad constructs were subcloned between BamHI and AgeI restriction sites in Gateway TagRFP-AS-N (Evrogen, Farmingdale, NY), in-frame with monomeric C-terminal RFP ...
-
bioRxiv - Molecular Biology 2020Quote: ... pre-washed cells were lysed in x1 Laemmli buffer and analyzed with one-dimensional PAGE followed by western blotting using Anti-TurboGFP(d) antibodies (Evrogen, Russia).
-
bioRxiv - Cell Biology 2019Quote: ... and SacI/PstI for the pTag-BFP-N to obtain pLEA-BFP (all plasmid backbones were from Evrogen, Milano, Italy). Correct clones were confirmed by Sanger sequencing using ABI PRISM 3100 (Applied Biosystem).
-
bioRxiv - Neuroscience 2020Quote: The caldendrin-tagRFP constructs were made by amplifying full length or caldendrin fragments from the pcDNA3.1/caldendrin vector and pasting them into the tagRFP-N plasmid (Evrogen, #FP142) using EcoRI and BamHI restriction and ligation.
-
bioRxiv - Plant Biology 2024Quote: ... except for the PCR fragments to make the proLecRK-I.9::LecRK-I.9::tagRFP and the proLecRK-I.9::LecRK-I.9Δkinase::tagRFP constructs which were inserted between the EcoRI and BamHI sites of the Gateway® tagRFP-AS-N entry vector (Evrogen, Moscow, Russia). After each transformation of Escherichia coli ...
-
bioRxiv - Plant Biology 2020Quote: ... or anti-tRFP (Evrogen)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-KillerRed (Evrogen AB961). All ChIP was performed using the SimpleChIP Enzymatic Chromatin IP kit with magnetic beads according to the manufacturer’s instructions (Cell Signaling Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-Tag(CGY)FP (Evrogen) was used at 1:1000 to detect mTagGFP2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-mKate (1:2500, Evrogen #AB233), anti-Cas9 (1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-KillerRed (Evrogen AB961; 1:5000), and anti-β-actin (Cell Signaling Technologies 4967 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-tagRFP (1:1000; AB233, Evrogen), anti-Por1 serum (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-TagGFP2 (Evrogen #AB121; 1:3000), anti-N1 ((Postigo & Way 2012) ...
-
bioRxiv - Microbiology 2024Quote: ... anti-RFP (1:2,000, AB233, Evrogen), rabbit anti-Src antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-tRFP Rabbit (Evrogen, 1:250). Secondary antibodies used were goat anti-Rabbit Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... rabbit anti-tRFP was from Evrogen (#AB233) and used against mKate2 to stain cystinosin-mKate2 ...
-
bioRxiv - Immunology 2022Quote: ... rabbit polyclonal anti-tagRFP (Evrogen, 1:1000). HRP-conjugated goat anti-mouse and goat anti-rabbit IgG (H+L ...