Labshake search
Citations for Evrogen :
1 - 50 of 90 citations for 6 Bromo N tert butyl 2 4 chlorophenyl imidazo 1 2 a pyridin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... TagRFP fragment without start codon was obtained by PCR with TagRFP-woATG-F 5’-GT CGGTACCGTGTCTAAGGGCGAAGAGCTG-3’ n BFPX3-R 5’-GCGCTTAAGTTAATTAAGCTTGTGCCCCA-3’ primers and pTagRFP-N vector (Evrogen) as a DNA source ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-Tag(CGY)FP (1:2000 in 0.5% milk TBST, 4°C o/n, Evrogen AB121). Blots were then incubated with IRDye 800/680 conjugated antibodies (1:10000 in 5% milk TBST ...
-
bioRxiv - Genomics 2023Quote: ... 2: rabbit anti-tRFP (1:1,000 dilution, polyclonal, Evrogen, AB233). The following secondary antibodies were used ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl 10x Taq Turbo buffer (Evrogen), 0.25 mM dNTPs ...
-
bioRxiv - Biophysics 2019Quote: Monomeric photoswitchable cyan fluorescence protein 2 (PS-CFP2, Evrogen) was C-terminally equipped with an AVI-tag (GLNDIFEAQKIEWHE ...
-
bioRxiv - Immunology 2023Quote: Monomeric photoswitchable cyan fluorescence protein 2 (PS-CFP2, Evrogen) featuring an unpaired cysteine residue and C-terminally extended with an AVI-tag (GLNDIFEAQKIEWHE ...
-
bioRxiv - Genomics 2020Quote: ... was performed using the Trimmer-2 cDNA normalisation kit (Evrogen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... with cDNAs were incubated at 68 °C for 2 minutes before adding pre-warmed DSN buffer mix with 1 Units of DSN enzyme (Evrogen). The reaction then performed at 68 °C for 20 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... or DMEMEGFP-2 anti-bleaching live cell visualization medium (Evrogen, #MCK02), both supplemented with 10% FBS and GlutaMAX-I (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... medium was replaced with live-cell visualization medium DMEMgfp-2 (Evrogen) supplemented with 10 % FBS ...
-
bioRxiv - Immunology 2021Quote: The RBD nucleotide sequence of SARS-CoV-2 Wuhan-Hu-1 isolate (Genbank accession number MN908947, from 319 to 545 aa) was synthesized (Evrogen, Russia) and cloned into the pCEP4 mammalian expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... pTAG-BFP-N (Evrogen, FP172) was used.
-
bioRxiv - Cell Biology 2021Quote: ... the medium was replaced by live-cell visualization medium DMEMgfp-2 (Evrogen) supplemented with 10% FBS and 2 mM L- glutamine ...
-
bioRxiv - Immunology 2021Quote: ... medium was replaced by live-cell visualization medium DMEMgfp-2 (Evrogen, cat. #MC102) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... medium was replaced by live-cell visualization medium DMEMgfp-2 (Evrogen, cat. #MC102) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or TagGFP2 (pTagGFP2-N vector, Evrogen) were used as controls for the crosstalk of the TagGFP2 signal into the red channel and the Katushka signal into the green channel ...
-
bioRxiv - Cell Biology 2019Quote: ... Media was exchanged to DMEMGFP-2 anti-bleaching live cell visualization medium (Evrogen # MCK02) supplemented with 10% FBS and GlutaMAX (Gibco #35050061 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the resulting product was cleaned from 2% agarose gel by Cleanup Standard Kit (Evrogen), digested by MluI and HindIII and ligated into pMV306/MluI ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were imaged in DMEM gfp-2 anti-bleaching live-cell imaging medium (Evrogen) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... with BFP from pTagBFP-N Vector (Evrogen) at EcoRI/XbaI) ...
-
bioRxiv - Systems Biology 2019Quote: ... Tissue-specific cDNA libraries were created using the Mint-2 cDNA Synthesis Kit (Evrogen, Russia) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated from total RNA (2 μg) by using MMLV reverse transcriptase (Evrogen, Russia). Reverse transcription PCR reaction conditions were as follows ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng of amplified products was mixed with 2 μL of 10X DSN buffer (Evrogen) and H2O to 20 μL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of total RNA and a reaction mixture with MMLV reverse transcriptase (Evrogen, Russia) were used ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and cloned into TagRFP-AS-N vector (Evrogen). The SsPrx03 and SsPrx03m1-TagRFP C-terminal fusion was then subcloned (LR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and vector pTurboGFP-N (Evrogen) were digested with XhoI and HindIII purified and ligated to generate pGADD34-TurboGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells expressing either Katushka (pTurboFP635-N vector, Evrogen) or TagGFP2 (pTagGFP2-N vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNA library was then normalized using the Trimmer-2 cDNA normalization kit (Evrogen, Moscow, Russia).
-
bioRxiv - Microbiology 2019Quote: ... the TagGFP2 sequence of the pTagGFP2-N vector (Evrogen) was amplified via PCR (5’-ATAAGAATTCCGGAATGAGCGGGGGCGAGGAG and 5’-CGGGGAATTCCATATGTTACCTGTACAGCTC primers ...
-
bioRxiv - Genomics 2023Quote: ... After 24-48 hours the coverslips were mounted in the GFP-imaging medium (DMEM-GFP-2, Evrogen) with rutin in a temperature-controlled chamber with CO2 and imaged on an inverted OMX Deltavision microscope in time-lapse mode ...
-
bioRxiv - Cell Biology 2022Quote: ... Red fluorescent protein expression vector pTagRFP-N were from Evrogen, Moscow ...
-
bioRxiv - Developmental Biology 2022Quote: ... mKate2 was amplified from the pmKATE2-N plasmid from Evrogen introducing flanking B2 and BamHIXhoI-B3 sequences and cloned into pGEM-T Easy ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TagCFP DNA fragment was amplified from pTagCFP-N (Evrogen) by PCR with the primers 5′-GAAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATACCGGTCGCC ACCATGAGCG-3′ and 5′-CCGGAATTCCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATACCACAACTAGAATGCAGTG-3′ ...
-
bioRxiv - Systems Biology 2020Quote: Cells were plated on 25 mm diameter coverslips (0.17 mm thick) in non-fluorescent media (DMEM gfp-2 with rutin; Evrogen). Coverslips were mounted in a temperature-controlled chamber with CO2 and imaged on an inverted OMXv3 Deltavision microscope in time-lapse mode ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway® TagRFP-AS-N entry clone (Evrogen). The PRX62-TagRFP fusion was subcloned (Gateway Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The fragment encoding tagRFP was PCR-amplified from pTagRFP-N (Evrogen). The fragments of ftsZ ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were incubated overnight at 4°C with primary antibodies targeting Tag(CGY)FP (1:2000 dilution in 1% milk, Evrogen, Cat#: AB121), HaloTag (1:1000 dilution in 0.5% milk ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... (ii) the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were sequenced on an Illumina NovaSeq 6000 platform (S Prime flow cell) with 2 × 150 bp paired-end reads (Evrogen Joint Stock Company, Russia).
-
bioRxiv - Molecular Biology 2020Quote: ... mIBP83 fragment of pEX-A2-SBP-T plasmid was subcloned into pTagGFP2-N vector (Evrogen) by PCR with the primers
-
bioRxiv - Plant Biology 2020Quote: Amplification of TALE genes was performed via a two-step PCR process in conjunction with primers 5’-GATCCCATTCGTTCGCGCACACCAAGTC-3’ and 5’-CTCCATCAACCATGCGAGCTCCTCTTCG-3’ and Taq DNA polymerase (Evrogen, Russia) under the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... The fixed cells were harvested (8000 g, 5 min, 4 °C) and resuspended in 1 mL of ExtractRNA Reagent (Evrogen, Russia) and the subsequent procedures were performed according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cytosolic expression was facilitated by expression of free Padron2 inserted into the TagRFP-N vector (Evrogen, Moscow, Russia) with enzymes AgeI and NotI ...
-
bioRxiv - Cell Biology 2022Quote: ... EB1-TagRFP was generated by PCR amplification from KAZUSA cDNA (NCBI AB463888) and inserted into pTagRFP-N (Evrogen). The shRNA target sequence was designed for protein knockdown using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... VE-cad constructs were subcloned between BamHI and AgeI restriction sites in Gateway TagRFP-AS-N (Evrogen, Farmingdale, NY), in-frame with monomeric C-terminal RFP ...
-
bioRxiv - Cell Biology 2019Quote: ... and SacI/PstI for the pTag-BFP-N to obtain pLEA-BFP (all plasmid backbones were from Evrogen, Milano, Italy). Correct clones were confirmed by Sanger sequencing using ABI PRISM 3100 (Applied Biosystem).
-
bioRxiv - Neuroscience 2020Quote: The caldendrin-tagRFP constructs were made by amplifying full length or caldendrin fragments from the pcDNA3.1/caldendrin vector and pasting them into the tagRFP-N plasmid (Evrogen, #FP142) using EcoRI and BamHI restriction and ligation.
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: 3) The coding sequence of the Tag-BFP (from pTag_BFP-Actin, Evrogen) borded with 2 XhoI sites ...