Labshake search
Citations for Lonza :
1 - 50 of 55 citations for hsa mir 320a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: ... and MycoAlert™ Control Set (Lonza, #LT07-518).
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Pathology 2021Quote: ... with the MycoAlert Assay Control Set (Lonza LT07-518) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MycoAlert™ control set (LT07-518, Lonza group Ltd.). The cells were all cultured in humidified sterile incubator conditioned at 5% CO2 at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... with MycoAlertTM Assay Control Set (Cat. no. LT07-518, Lonza) and found to be free from mycoplasma contamina- tion ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for 1 h at RT in PBS (Lonza, Basel, Switzerland) containing 5% FBS and 0.2% Triton X-100 ...
-
bioRxiv - Bioengineering 2022Quote: ... and assay performance was validated using negative and positive controls (MycoAlert™ Assay Control Set, Lonza #LT07-518).
-
bioRxiv - Microbiology 2022Quote: ... transfection was performed with 3.5 μg of PF16eYFPNeo introduced into 108 cells using a Human T-cell kit and IIb Nucleofector set to program X-001 (Lonza). Other transfections described in this work used the same conditions except with Tb-BSF buffer (90 mM sodium phosphate ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... Cells were then washed with CyFACS buffer and incubated for 5min at RT in 1xPBS (Lonza) with 1/1000 diluted cisplatin (Fluidigm) ...
-
bioRxiv - Cell Biology 2019Quote: ... Flies were then dissected at room temperature (RT) in Grace’s Insect Medium (modified) (BioWhittaker, Lonza, Cologne, Germany). Ovaries were homogenized in 150 uL of sample buffer and proteins were separated on 4-20% polyacrylamide gels using a standard SDS-PAGE protocol for Western blotting ...
-
bioRxiv - Biophysics 2021Quote: ... 10 pmol of the cholesterol-modified reverse primer and 1μL 20X SYBR® Green I Nucleic Acid Stain (Lonza) were mixed with the KAPA2G Fast HotStart ReadyMix in a total volume of 20 μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1.5 uL of 2ug/uL ABE8e-NRCH ribonucleoprotein editor,83 1uL of base editor primer (50uM stock) and 3.6uL of Nucleofector supplement (Lonza). The ABE8e-NRCH base editor was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... 3x 10 flies were then dissected at room temperature (RT) in Grace’s Insect Medium (modified) (BioWhittaker, Lonza, Cologne, Germany). Ovaries were fixed for 20 minutes in 4% paraformaldehyde and 20mM formic acid solution (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... and human ACTB (assay control, primer composition not disclosed by manufacturer) were loaded on a 2.5% agarose gel (Lonza, 50010) and stained with GelRed® (Merck ...
-
bioRxiv - Immunology 2021Quote: ... 10×106 CD8+ T cells were resuspended in 250 µL of RT red phenol-free serum-free TheraPEAKTM X-VIVOTM-15 (BEBP02-061Q, Lonza). 10 µg of RNA coding for the α and β chains of the TCR recognizing the S7C epitope of NY-ESO-1 presented on HLA-A*02:01 (NY-ESO (157-165) ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragments underwent PCR-based amplification using Illumina’s Nextera® primers and the resulting libraries were subjected to electrophoresis for the indicated time in 1% agarose gels (Lonza) at 3.0 V cm-1 in TBE buffer (50 mM Tris-borate ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were separated on 3.5% MetaPhor Agarose gel (Lonza). When both genotyping and phenotypic analyses of single zebrafish embryos from heterozygous bach2a intercross was needed ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were separated on a 2% MetaPhor agarose (Lonza) gel with SYBRSafe (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was analyzed in 1.5% agarose (Lonza 50002) gel stained by SYBR Safe (Invitrogen S33102 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Genetics 2019Quote: ... All PCR products were monitored with FlashGels (Lonza, Basel, Switzerland) to confirm the anticipated length depending on locus ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were run on 2.2% agarose gels (Lonza 57031) and imaged using Philips VLounge software ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed 1x in RT PBS and transfected with ∼15μg of DNA plasmid using Amaxa nucleofector 2b (Lonza, program O-005). After transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR products were separated on homemade MetaPhor agarose gel (Lonza) and stained with GelRed ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR samples were analyzed on 2% agarose gels (Lonza Rockland, ME), 1X TAE ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... and tested for mycoplasma using PCR and biochemical test (MycoAlert, Lonza).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were separated on a 2% MetaPhorTM agarose gel (Lonza) and smeared amplicons were gel-excised using the MinElute gel extraction Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were size-selected using 3% NuSieve agarose gels (Lonza) followed by gel extraction using QIAEX II reagents (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were resolved on a MetaPhor gel (Lonza, Basel, Switzerland) and sequenced ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were run on 4% Nusieve agarose gel (Cat #50090, LONZA) for higher resolution of bands separation results (Witt ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the resulting PCR products were analyzed on a 3 % MetaPhorTM (Lonza) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR cycle number was evaluated using a FlashGelTM System (Lonza, 57063). The volume of the PCR product was adjusted to 100 μL by adding 50 µl TE buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were resolved on 2% high-resolution Metaphor agarose gels (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... PCR products were loaded on 1.5% agarose gel (Lonza SeaKem LE Agarose) at constant voltage of 70V for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR samples were visualized on 1.5% SeaKem LE agarose (Lonza; Rockland, ME) gels containing 0.5x GelRed (Biotium ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were visualized on a FlashGel™ system (Lonza, Basel, Switzerland), cleaned up using ExoSAP-IT Express (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR tubes were placed above a gel-viewing blue LED powered light box (Lonza Flashgel Dock or IO Rodeo Midi Blue LED Transilluminator ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR products and double-stranded DNAs were purified with agarose gels (Lonza, 50004) and the GeneJet Gel Extraction Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were checked regularly for mycoplasma contamination by PCR (MycoAlert™ Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were regularly tested for mycoplasma contamination by PCR and MycoAlert Mycoplasma Detection Kit (Lonza). Avapritinib and MK-1775 were obtained from Selleckchem (Houston ...
-
bioRxiv - Plant Biology 2023Quote: ... and PCR products were separated by agarose gel electrophoresis in an 1% w/v agarose gel (Lonza, 50004) using 100V during 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product presence was confirmed with gel electrophoresis using the FlashGel® System (Lonza, Rockland, ME, USA). PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics ...
-
bioRxiv - Microbiology 2019Quote: ... TGGT1_265180 knockout and parental parasites were transfected with 1µg of either the full-length (265180-HA) or truncated (265180ΔSID-HA) PCR amplicons and 2µg of pSAG1-Cas9-sgKu80 using the Nucleofector™ (Lonza). Parasites were selected for the presence of DHFR ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were authenticated by Brca1/2-specific PCR-based genotyping (mouse)7,8 and they were regularly tested for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... All cell lines were tested for mycoplasma at each batch freezing by PCR (32) and biochemical assay (MycoAlert, Lonza).