Labshake search
Citations for Lonza :
1 - 50 of 268 citations for Water Nuclease Free Dist since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and 7 mM Na2HPO4 in nuclease-free water) using either the Amaxa nucleofector system II (Lonza) under nucleofection program T-005 or the Amaxa 4Dnucleofector system (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... Homogenized samples were then diluted 1:5 in endotoxin free water in pyrogen-free glass tubes (Lonza N207) and tested for endotoxin in duplicate using a Kinetic-QCL™ LAL Assay (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... and 3.3% glycerol was made in endotoxin-free LAL reagent water (Lonza). The lecithin-glycerol-water solution was used as a vehicle ...
-
bioRxiv - Neuroscience 2022Quote: ... the samples were rapidly transferred to glass Dounce homogenizers and homogenized in 750µL of endotoxin free water (Lonza W50-100). Homogenized samples were then diluted 1:5 in endotoxin free water in pyrogen-free glass tubes (Lonza N207 ...
-
bioRxiv - Microbiology 2019Quote: ... the precipitates were allowed to dry and then resuspended in 100 µL of DNase-free water (Lonza, Rockland, ME, USA) and kept at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... acetylated chitin oligomers were suspended in endotoxin free water and tested for endotoxin level by using the limulus amebocyte lysate (LAL) assay (Lonza, CH). Levels below 0.25 EU/ml (<25 pg/ml LPS ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 pmol Cas9 nuclease (sgRNA to Cas9 nuclease ratio used as 9:1) was performed with Amaxa 2D Nucleofector (Lonza, program B016). After recovery ...
-
bioRxiv - Cancer Biology 2020Quote: ... recombinant Cas9 nuclease (IDT) and the 4D-Nucleofector (Lonza) as previously described (Wagenblast et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Biowhittaker water (10%, Lonza, BE17-724F) and DNase I (400U ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 μL molecular grade water (Lonza). Each primer pair was tested using a 5-point serial dilution to ensure an efficiency between 90-100% and meltcurve analysis was performed after each run to check for the presence of a single PCR product ...
-
bioRxiv - Cell Biology 2021Quote: LECs were pre-cultured with FBS-free and supplement-free EGM2 medium (Lonza) for 24 h ...
-
bioRxiv - Genomics 2021Quote: ... and 16.68 μl AccuGene molecular biology water (Lonza). qPCR cycling conditions were 95°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... UltraCulture serum-free medium (Lonza) supplemented with 1 mM L-glutamine (Life Technologies ...
-
bioRxiv - Genomics 2020Quote: ... 1ml antibiotic-free DMEM (Lonza) was prepared and incubated in 24-well plates at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... and mycoplasma free (Mycozap antibiotics, Lonza), and both cell lines were regularly splitted every 2-3 days ...
-
bioRxiv - Cell Biology 2021Quote: ... in serum-free EBM-2 (Lonza) for 4 hours at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... All cells were mycoplasma free (Lonza) and grown at 37°C and 5% CO2.
-
bioRxiv - Immunology 2022Quote: ... X-VIVO15 serum-free media (Lonza) was used to avoid T cell activity to bovine serum proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... and verified mycoplasma free by Lonza MycoAlert mycoplasma detection kit (LT07 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Phenol Red-free (Lonza, CC-3153), containing epidermal growth factor (5 ng/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 Nuclease V3 (IDT) and 3.0 μg donor fragment per 100 μL of Nucleofector™ Solution V (Lonza) using the Amaxa Nucleofector II (Lonza) ...
-
bioRxiv - Genomics 2022Quote: ... and 16.68 μL AccuGene molecular biology water (Lonza, Basel, CH). qPCR cycling conditions were 95°C for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... and washed twice with TC-grade water (Fisher Lonza; BW17724Q) the next day ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... adapted to serum-free Insect Xpress (Lonza) medium were co-transfected with pMT/BIP/IrSPI and the pCoPURO vector (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and serum free media (Lonza, BEBP12-764Q) was added ...
-
bioRxiv - Microbiology 2021Quote: ... magnesium-free PBS (CMF-PBS, Lonza, UK). Cells were fixed with 100 μL 10% neutral buffered Formalin (Thermofisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... using serum-free MEBM (Lonza, Basel, Switzerland) medium (SFM ...
-
bioRxiv - Biophysics 2023Quote: ... 150µl serum-free media (Insect-XPRESS, Lonza) was added to the 24 deep well plate ...
-
bioRxiv - Biochemistry 2024Quote: ... in serum-free Insect-XPRESS medium (Lonza) were infected with recombinant virus (MOI>2 ...
-
bioRxiv - Cell Biology 2020Quote: ... complex containing Alt-R HiFi Cas9 Nuclease (IDT) and a tracrRNA:crRNA duplex (crRNA sequence: GGTCGTTGAGGACTTCCACA) using program CM150 of the Amaxa 4D Nucleofector (Lonza). Briefly ...
-
bioRxiv - Bioengineering 2023Quote: ... single guide hybrids were mixed with 3uM Cas9 nuclease (Berkeley Labs) at a 1.2:1 ratio and delivered to cells by Lonza 3D (CA-137 ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested EV pellet was resuspended in 1 mL RNase-free Phosphate buffered saline (RNase-free PBS, Lonza, Australia) and washed using ultracentrifugation at 100,000 × g for 60 min at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... was prepared by mixing 250 nmol target gene sgRNA+ 50 nmol eGFP sgRNA+ 50 nmol SpCas9 2NLS Nuclease (Synthego) in 50 μL mouse B cell nucleofection buffer (Lonza) at RT for 30min ...
-
bioRxiv - Microbiology 2023Quote: ... or 1×106 CEM-M7 Cas9 cells were transfected with the HiFi Cas9 Nuclease V3 (IDT)/gRNA complex (80 pmol/300 pmol) (Lonza) using a non-targeting or a GRN(5’-GCGATCCTGCTTCCAAAGATC-3’) ...
-
bioRxiv - Immunology 2023Quote: ... Mixtures of complexed sgRNA and Cas9 (0.3 nmol synthetic sgRNA + 62 µmol Cas9 nuclease) and 2-10×106 enriched murine CD8+ T cells were suspended in 25ul of P3 electroporation buffer (Lonza) and electroporated using the Lonza 4D Nucleofector (pulse code DN100) ...
-
bioRxiv - Immunology 2021Quote: ... 10×106 CD8+ T cells were resuspended in 250 µL of RT red phenol-free serum-free TheraPEAKTM X-VIVOTM-15 (BEBP02-061Q, Lonza). 10 µg of RNA coding for the α and β chains of the TCR recognizing the S7C epitope of NY-ESO-1 presented on HLA-A*02:01 (NY-ESO (157-165) ...
-
bioRxiv - Genetics 2023Quote: ... They were then reprogrammed to iPSCs by using a transient expression method (nucleofection) involving three plasmid vectors (MOS, MMK and GBX) under feeder-free/xeno-free culture on 4D Nucleofector (Lonza)11 ...
-
bioRxiv - Neuroscience 2022Quote: ... serum-free hematopoietic cell medium (Lonza, #BE04-380Q) prior coating the plates ...
-
bioRxiv - Cell Biology 2021Quote: ... Mycoplasma-free HMLE cells were purchased from Lonza and they were grown in a mixture of 50% complete Mammary Epithelial Growth Medium (MGEM ...
-
bioRxiv - Immunology 2020Quote: ... resuspended in endotoxin-free PBS (D-PBS Lonza), counted under dark field microscopy using a Petroff-Hauser chamber and diluted to the appropriate concentration ...
-
bioRxiv - Cancer Biology 2024Quote: ... mycoplasma free (Lonza #LT07-318, #LT07-518 (control) melanoma cell lines were seeded in 6 well tissue cultured dishes in RPMI 1640 (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... filtered water and one wash in Dulbecco’s phosphate buffered saline (DPBS, Lonza). For Drosophila neurons ...
-
bioRxiv - Immunology 2023Quote: ... Electroporation was performed with sgRNA/Cas9 RNP complexes using Alt-R Sp Cas9 Nuclease V3 (IDT) and using the 4D-Nucleofector with P3 Primary Cell 4D Nucleofector X Kit S (Lonza Bioscience).
-
bioRxiv - Cell Biology 2021Quote: ... iPSCs were verified free of mycoplasma using MycoAlertTM (Lonza). Cardiac differentiations were performed using Wnt modulation.1,2 We achieved optimal differentiations using RPMI plus B27 supplement without insulin during day 0-2 (CHIR 5-6 µM during first 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... antibodies in serum-free X-Vivo 20 medium (Lonza), in the absence (Th0 ...
-
bioRxiv - Cell Biology 2021Quote: ... calcium-free medium designed for epithelial cell growth (Lonza). In the growth medium-KGM Gold mix (at a 1:4 dilution) ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 10% (v/v) tetracycline-free FBS (Lonza), 50 U/mL Penicillin/Streptomycin (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were starved in methionine/cysteine-free DMEM (Lonza) plus 10% dialyzed FCS (10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were mycoplasma free (MycoAlert, Lonza, Basel, Switzerland).
-
bioRxiv - Biochemistry 2023Quote: ... red phenol-free Hank’s Balanced Salt Solution (HBSS, Lonza) supplemented with HEPES (1mM ...