Labshake search
Citations for Lonza :
101 - 150 of 246 citations for Tripartite Motif Containing Protein 55 TRIM55 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... The isolated adult CMs were finally re-suspended in plating medium containing Medium 199 (Lonza, BE12-117F), 1% penicillin/streptomycin (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.3) containing 10 μg DNA and transfected by electroporation using an AMAXA Nucleofector® Device (Lonza) with program “X-001 free choice” ...
-
bioRxiv - Immunology 2024Quote: ... T cells were cultured in T cell medium containing X-VIVO™ 15 media (Lonza, Basel, Switzerland), 10% human AB serum (Corning Inc. ...
-
bioRxiv - Neuroscience 2024Quote: ... Trypsin was inactivated by adding an equal volume of DMEM/F12 containing 20% FBS (Lonza, Bio Whittaker). Cerebral cortex was dissociated by trituration in DMEM/F12 containing 10% FBS and 20 µg/ml DNase I (Roche ...
-
bioRxiv - Immunology 2020Quote: ... both grown in Insect-XPRESS Protein-free Insect Cell Medium (Lonza, BE12-730Q) supplemented with L-glutamine (to 1%) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (EGM2 media without supplementation with EGF, FGF2 and VEGF-A; Lonza) and macrophage media (v/v ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 µl OptiMEM were mixed with 0.75 µl Lipofectamine and then added to 25 µl OptiMEM containing 0.1 µg GFP pMAX plasmid (Lonza) and 1 µl P3000 reagent ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed with PBS and incubated in flu media containing 1% SeaPlaque agarose (Lonza, Basel, Switzerland). After 48hr incubation ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in an equal volume of DMEM containing 20% FBS and 200 U/ml of penicillin/streptomycin (Lonza), and ∼1.5×104 hemolymph sporozoites were added per well ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: K562 cells containing deletions in ALAS2 or FECH were created using a multi-guide strategy via nucleofection (Lonza) of Cas9/RNP complexes (Gene Knockout Kit v2 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Microbiology 2020Quote: ... cultured in Insect-XPRESS Protein-free Insect Cell Medium supplemented with L-glutamine (Lonza). A Sf21 cell culture of ∼1.8 × 106 cells/ml was inoculated with the third passage stock of virus and incubated for three days at 28 °C ...
-
bioRxiv - Immunology 2022Quote: ... the protein extraction was done with IP buffer (50 mM Hepes pH 7,5 (Lonza), 150 mM NaCl (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... dissected samples were pulled onto a coverslip containing an agarose pad made of 1% low-melt agarose (Lonza #50100) dissolved in Tyrode’s buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... culture conditions and characterization: The isolated epidermis was placed in a petri dish containing HBSS buffer (Lonza, # CC-5022) for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... HLFs were seeded in four wells of a 24-well plate in antibiotic free medium containing 2 % (Lonza, PromoCell) or 10 % (DZL ...
-
bioRxiv - Neuroscience 2023Quote: ... We then placed a 100 μL droplet of the ice-cold monomer solution containing 0.1% (wt/vol) ammonium persulfate onto a hydrophobic glass plate treated with GelSlick (Lonza). The coverslip bearing the flattened sample was then inverted onto the droplet to form a uniform layer of monomer solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... containing 10 μg of the plasmid DNA and transfected using the program DS-112 of the 4D-nucleofector (Lonza). NSCs were harvested 48 hours post-nucleofection ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were first thawed and seeded on a T150 flask containing bronchial epithelial growth medium (Lonza CC-3170) for 2D cell culture growth ...
-
bioRxiv - Immunology 2023Quote: ... one plate was prepared with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Immunology 2023Quote: ... cells were grown in standard keratinocyte growth medium TM 2 (KGMTM-2) containing 0.15 mM CaCl2 (low Ca– KGM-2; Lonza) without gentamycin ...
-
bioRxiv - Neuroscience 2023Quote: ... containing ∼1000 neurons) was transferred to 9 mL of wash media (DMEM/F12 with penicillin/streptomycin [Lonza; Allendale, NJ]), then recovered by centrifugation (∼350 xG ...
-
bioRxiv - Cancer Biology 2023Quote: Invasion assays were performed using human bronchial epithelial cells grown on collagen discs containing primary human pulmonary fibroblasts (Lonza Bioscience ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2024Quote: ... resuspended in 100 µL nucleofection buffer containing RNP and electroporated according to manufacturer’s instructions using the 4D-Nucleofector (Lonza). Control cells were electroporated with SpCas9 nuclease only.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cell suspension was mixed with a mixture (66 μl per plug) containing 0.83% low-melting-point agarose (SeaPlaque GTG; Lonza), 170 mM sorbitol ...
-
bioRxiv - Developmental Biology 2024Quote: ... anesthetized by incubation in egg water containing 0.003 % Tricaine and embedded laterally in 1 % low melting agarose (Lonza 50081) containing 0.16 mg/mL Tricaine in glass-bottom dishes (MatTek ...
-
bioRxiv - Bioengineering 2024Quote: hMSC were plated at 15,000 cells/well in 24-well plates and grown overnight in a growth medium containing 10% FBS (Lonza). When cells reach 80% confluency ...
-
bioRxiv - Bioengineering 2024Quote: hMSC were plated at 15,000 cells/well in 24-well plates and grown overnight in a growth medium containing 10% FBS (Lonza). Once cells reached 80% confluency ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stained with surface antibodies in PBS (Lonza) + 2% FCS ...
-
bioRxiv - Immunology 2021Quote: ... antibodies in serum-free X-Vivo 20 medium (Lonza), in the absence (Th0 ...
-
bioRxiv - Immunology 2022Quote: Cells were stained with surface antibodies in PBS (Lonza) + 2% FCS ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in Insect-XPRESS™ Protein-free Insect Cell Medium (Lonza; 12-730Q) supplemented with antibiotic-antimycotic (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were maintained in Insect-XPRESS protein-free insect cell media with L-glutamine (Lonza) and infected at a density of 3-4 x 106 with high-infectivity baculovirus for protein expression.
-
bioRxiv - Bioengineering 2022Quote: Human umbilical vein endothelial cells expressing green fluorescent protein (GFP-HUVECs) (C2519A, Lonza, Basel, Switzerland) were cultured in a supplemented (EGM-2 bullet kit ...
-
bioRxiv - Bioengineering 2024Quote: Human umbilical vein endothelial cells expressing green fluorescent protein (GFP-HUVECs) (C2519A, Lonza, Basel, Switzerland) were cultured in a supplemented (EGM-2 bullet kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Cell Biology 2020Quote: ... aliquots of obtained BM aspirates were seeded into cell culture flasks containing endothelial basal media (EBM-2, Lonza, Cologne, Germany) supplemented with 10% human platelet lysate (PL ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pmel-1 CD8+ T cells were activated by incubating with R10 media (RPMI containing 10 % FBS, 100 U/mL penicillin and 100 mg/mL streptomycin (all Lonza), 1x MEM NEAA ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with 5μg of selected plasmid (control, empty vector (EV) or containing guide RNAs using Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 2×105 143B or HEK293T cells were resuspended in the resulting solution containing ribonucleoprotein complexes (RNPs) and electroporated using a 4D-Nucleofector (Amaxa, Lonza) programs FP-133 (143B ...
-
bioRxiv - Bioengineering 2019Quote: ... approximately 200,000 cells were resuspended in a mixture containing 20 µl of P3 Primary Cell Nucleofector™ solution (V4XP-3032, Lonza), 5 µl of RNP complex for each guide (both guides AC and AD ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Neuroscience 2019Quote: ... of viral supernatants were used to infect E2T cells (5 x 105 cells/well in 6-well plate) for plaque assays and cells were maintained in culture medium containing 5% SeaPlaque agarose (Lonza) until plaques become visible at ∼12 days after infection ...
-
bioRxiv - Genetics 2020Quote: ... 2×105 UE control hPSCs were transfected with a pair of pSpCas9(BB)-2A-GFP constructs containing the specific sgRNAs (350 ng per construct) using P3 Primary Cell 4D-Nuclecfector X Kit (Lonza). The transfected cells were plated in Matrigel-coated dish and cultured for 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... 5,000 cells were plated in low-attachment 96-well plates containing 100 µL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL FGF (Sigma Aldrich) ...