Labshake search
Citations for Lonza :
1 - 50 of 876 citations for Recombinant Zebrafish IL 1 beta Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Molecular Biology 2020Quote: ... Zebrafish larvae were subsequently washed and were embedded in 0.8% seaPlaque low melting Agarose (Lonza) supplemented with 160 mg/L tricaine (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2024Quote: ... and recombinant human insulin 0.5%) (Lonza). Human cervical cancer cell line SiHa from ATCC (ATCC® HTB-35™ ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Genetics 2024Quote: 61 pmol Recombinant Alt-RspCas9 protein (IDT) in 10 µL of Human Keratinocyte Nucleofector™ Kit solution (Lonza, VPD-1002) for 10 min and immediately used for nucleofection of 8×105 primary keratinocytes with the Amaxa nucleofection apparatus (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... Zebrafish larvae of 5 dpf were embedded in 0.8% seaPlaque low melting Agarose (Lonza, Basel, Switzerland) supplemented with 160 mg/L tricaine (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg ml−1 streptomycin and 15 ng ml−1 recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 0.1 μg/ml of interleukin (IL)-34 (IL-34) (Lonza, Basel-Stadt, Switzerland), 0.01 μg/ml of granulocyte-macrophage colony-stimulating factor (GM-CSF ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 0.1 μg/mL of interleukin (IL)-34 (IL-34) (Lonza, Basel-Stadt, Switzerland), 0.01 μg/mL of granulocyte-macrophage colony-stimulating factor (GM-CSF ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Cancer Biology 2020Quote: ... recombinant Cas9 nuclease (IDT) and the 4D-Nucleofector (Lonza) as previously described (Wagenblast et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant insulin (20 μg/mL, Lonza, #BE03-033E20), human recombinant EGF (2 ng/mL ...
-
bioRxiv - Immunology 2022Quote: ... Co-cultures were done in IMDM supplemented with 5% HI-HS (Lonza) and gentamycin (86 μg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The recombinant plasmid was transfected into HT29 cells using 4D-Nucleofecor (Lonza).
-
bioRxiv - Bioengineering 2024Quote: ... at a ratio of 3:1 bead/cell and 20 IU of IL-2 (Preprotech, 200-02) in X-Vivo media (Lonza, 02-053Q) supplemented with 5% human serum and Pen/Strep ...
-
bioRxiv - Biophysics 2020Quote: ... hydrocortisone and recombinant human epidermal growth factor (MEGM Bullet Kit CC-4136; Lonza). Cells were maintained in an incubator under standard conditions (36.5 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmids mEmerald-JUP-C-14 and mEmerald-Beta-Catenin-20 were transfected in 3T3-L1 pre-adipocytes by Nucleofection (Lonza). mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Bioengineering 2023Quote: The PyroGene Recombinant Factor C Endpoint Fluorescent Assay (Lonza, Walkersville, MD, cat # 50-658U) was performed as recommended ...
-
bioRxiv - Immunology 2022Quote: ... Absence of endotoxins (< 1EU/mL) was confirmed using the PyroGene™ Recombinant Factor C Assay (Lonza) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... culture media supplemented with 0.1μg/ml of inter-leukin (IL)-34 (Lonza, Basel-Stadt, Switzerland) and 0.01μg/ml of granulocyte-macrophage colony-stimulating factor (GM-CSF ...
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 100 μg/ml streptomycin and 15 ng/ml recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA and recombinant CAS9 were delivered as ribonucleoprotein (RNP) complexes using a 4D-Nucleofector X-Unit (Lonza). Briefly ...
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... The purity of CyaA batches is higher than 90% as judged by SDS PAGE analysis and contained less than 1 EU of LPS/μg of protein as determined by a standard LAL assay (Lonza). Finally ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... and the manufacturer’s instructions were followed (PyroGene Recombinant Factor C Endpoint Fluorescent Assay-#50-658U, Lonza Bioscience, Walkersville, MD, USA). Serum samples were diluted at 1:50 for LBP analysis ...
-
bioRxiv - Immunology 2023Quote: ... at bead-to-cell ratio of 1:1 in human IL-2 medium (X-VIVO 15, serum-free hematopoietic cell medium, with 2mM L-Glutamine and gentamicin (Lonza) supplemented with 5% Human AB serum (Valley Medical) ...
-
bioRxiv - Genetics 2024Quote: ... we assembled Cas9/gRNA RNP complexes in vitro by mixing 16 μg of recombinant Cas9 (IDT) and 120 pmol of in vitro transcribed gRNA (IDT) in 100 μl of SE buffer (Lonza, cat# PBC1-00675) and incubating at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2021Quote: ... 1.6×105 cells were suspended in P3 Primary Cell Solution with 50pmol Cas9 protein (St. Jude Protein Production Core) and 150pmol sgRNA (Synthego) with pMaxGFP plasmid at 200ng/ul (Lonza) in a total volume of 20ul with program DS130 ...
-
bioRxiv - Genomics 2021Quote: ... and 50 pmole of spCas9 protein (St. Jude Protein Production Core) with pMaxGFP plasmid as a transfection control at 200ng/ul (Lonza) using the 4D-Nucleofector™ X-unit (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were separated by SDS-PAGE using 14% Prosieve (Lonza) polyacrylamide gels and electroblotted to Immobilon-P membranes (Millipore) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with Cas9 ribonucleic protein (RNP) complexes in SF buffer (Lonza), using the pulse codes CM-150 or CV-104 ...
-
bioRxiv - Cancer Biology 2020Quote: ... consisting of 100 pmol of chemically modified sgRNA (Synthego) and 35 pmol of Cas9 protein (St. Jude Protein Production Core) via nucleofection (Lonza, 4D-Nucleofector™ X-unit) using solution P3 and program CA-137 in small cuvettes according to the manufacturers recommended protocol ...
-
bioRxiv - Microbiology 2020Quote: ... the medium was removed and replaced by Ultradoma Protein-Free (LONZA). The cultured medium was harvested and replenished on the second ...
-
bioRxiv - Genetics 2022Quote: ... membranes were stained with SYPRO-Ruby Protein Gel Stain (Lonza Rockland) to confirm equal loading ...
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Systems Biology 2024Quote: ... electroporated with sgRNAs and Cas9 protein (Lonza Nucleofector, program A-24), and replated into 24 well plates ...
-
bioRxiv - Cell Biology 2023Quote: ... S2Xpress cells were cultured in Insect-XPRESSTM protein-free medium (LONZA, Belgium) supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin (GIBCO) ...
-
bioRxiv - Immunology 2023Quote: ... Protein expression was induced with 5µM CdCl2 in Insect-XPRESS medium (Lonza) for 5-7 days and supernatants were concentrated and purified using strep-tacting affinity chromatography columns in an AKTA FPLC system ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 21°C in Insect Xpress Protein-free Insect Cell Medium (Lonza) supplemented with GlutaMAX (GIBCO ...
-
bioRxiv - Immunology 2020Quote: ... both grown in Insect-XPRESS Protein-free Insect Cell Medium (Lonza, BE12-730Q) supplemented with L-glutamine (to 1%) ...
-
bioRxiv - Microbiology 2020Quote: ... cultured in Insect-XPRESS Protein-free Insect Cell Medium supplemented with L-glutamine (Lonza). A Sf21 cell culture of ∼1.8 × 106 cells/ml was inoculated with the third passage stock of virus and incubated for three days at 28 °C ...
-
bioRxiv - Immunology 2022Quote: ... the protein extraction was done with IP buffer (50 mM Hepes pH 7,5 (Lonza), 150 mM NaCl (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in Insect-XPRESS™ Protein-free Insect Cell Medium (Lonza; 12-730Q) supplemented with antibiotic-antimycotic (Thermo Fisher ...