Labshake search
Citations for Lonza :
1 - 50 of 191 citations for Recombinant Mouse PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Bioengineering 2024Quote: ... and recombinant human insulin 0.5%) (Lonza). Human cervical cancer cell line SiHa from ATCC (ATCC® HTB-35™ ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Genetics 2024Quote: 61 pmol Recombinant Alt-RspCas9 protein (IDT) in 10 µL of Human Keratinocyte Nucleofector™ Kit solution (Lonza, VPD-1002) for 10 min and immediately used for nucleofection of 8×105 primary keratinocytes with the Amaxa nucleofection apparatus (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... recombinant Cas9 nuclease (IDT) and the 4D-Nucleofector (Lonza) as previously described (Wagenblast et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant insulin (20 μg/mL, Lonza, #BE03-033E20), human recombinant EGF (2 ng/mL ...
-
bioRxiv - Immunology 2022Quote: ... Co-cultures were done in IMDM supplemented with 5% HI-HS (Lonza) and gentamycin (86 μg/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... The recombinant plasmid was transfected into HT29 cells using 4D-Nucleofecor (Lonza).
-
bioRxiv - Biophysics 2020Quote: ... hydrocortisone and recombinant human epidermal growth factor (MEGM Bullet Kit CC-4136; Lonza). Cells were maintained in an incubator under standard conditions (36.5 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... HiFi Cas9 Nuclease V3 protein (IDT, 1081058) were introduced into low-passage dual-reporter ESCs using the Mouse Embyronic Stem Cell Nucleofector Kit (Lonza VPH-1001). ESCs were treated with 0.025% trypsin/1% EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: The PyroGene Recombinant Factor C Endpoint Fluorescent Assay (Lonza, Walkersville, MD, cat # 50-658U) was performed as recommended ...
-
bioRxiv - Immunology 2022Quote: ... Absence of endotoxins (< 1EU/mL) was confirmed using the PyroGene™ Recombinant Factor C Assay (Lonza) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 100 μg/ml streptomycin and 15 ng/ml recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA and recombinant CAS9 were delivered as ribonucleoprotein (RNP) complexes using a 4D-Nucleofector X-Unit (Lonza). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg ml−1 streptomycin and 15 ng ml−1 recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... and the manufacturer’s instructions were followed (PyroGene Recombinant Factor C Endpoint Fluorescent Assay-#50-658U, Lonza Bioscience, Walkersville, MD, USA). Serum samples were diluted at 1:50 for LBP analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... we assembled Cas9/gRNA RNP complexes in vitro by mixing 16 μg of recombinant Cas9 (IDT) and 120 pmol of in vitro transcribed gRNA (IDT) in 100 μl of SE buffer (Lonza, cat# PBC1-00675) and incubating at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2021Quote: ... 1.6×105 cells were suspended in P3 Primary Cell Solution with 50pmol Cas9 protein (St. Jude Protein Production Core) and 150pmol sgRNA (Synthego) with pMaxGFP plasmid at 200ng/ul (Lonza) in a total volume of 20ul with program DS130 ...
-
bioRxiv - Genomics 2021Quote: ... and 50 pmole of spCas9 protein (St. Jude Protein Production Core) with pMaxGFP plasmid as a transfection control at 200ng/ul (Lonza) using the 4D-Nucleofector™ X-unit (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the mouse ES cell nucleofection kit (Lonza) using protocol “A24” ...
-
bioRxiv - Bioengineering 2023Quote: Mouse C57 Cortex Neurons (Lonza, M-CX-300) were cultured in Primary Neuron Basal Medium (PNBM ...
-
bioRxiv - Immunology 2023Quote: ... X-Unit (Lonza, program: unstimulated mouse T cells). Cells were washed immediately after nucleofection to remove nucleofection reagents and improve survival.
-
bioRxiv - Neuroscience 2024Quote: ... and mouse neuron nucleofectorTM kit (VPG-1001, Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were separated by SDS-PAGE using 14% Prosieve (Lonza) polyacrylamide gels and electroblotted to Immobilon-P membranes (Millipore) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with Cas9 ribonucleic protein (RNP) complexes in SF buffer (Lonza), using the pulse codes CM-150 or CV-104 ...
-
bioRxiv - Cancer Biology 2020Quote: ... consisting of 100 pmol of chemically modified sgRNA (Synthego) and 35 pmol of Cas9 protein (St. Jude Protein Production Core) via nucleofection (Lonza, 4D-Nucleofector™ X-unit) using solution P3 and program CA-137 in small cuvettes according to the manufacturers recommended protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Systems Biology 2024Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Cell Biology 2024Quote: ... Amaxa Mouse ES Cells Nucleofector Kit (VPH-1001, Lonza, Switzerland) or Lipofectamine LTX and Plus Reagent (15338-100 ...
-
bioRxiv - Microbiology 2020Quote: ... the medium was removed and replaced by Ultradoma Protein-Free (LONZA). The cultured medium was harvested and replenished on the second ...
-
bioRxiv - Genetics 2022Quote: ... membranes were stained with SYPRO-Ruby Protein Gel Stain (Lonza Rockland) to confirm equal loading ...
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Systems Biology 2024Quote: ... electroporated with sgRNAs and Cas9 protein (Lonza Nucleofector, program A-24), and replated into 24 well plates ...
-
bioRxiv - Cancer Biology 2021Quote: ... expressing Cas9 and sgRNA targeting mouse p53 and pmaxGFP plasmid (Lonza). Similarly ...
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Immunology 2024Quote: ... using the Amaxa Mouse Dendritic Cell Nucleofector Kit (#VPA-1011, Lonza) as previously described (12 ...