Labshake search
Citations for Lonza :
1 - 50 of 132 citations for Recombinant Mouse Acvr2a His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and recombinant human insulin 0.5%) (Lonza). Human cervical cancer cell line SiHa from ATCC (ATCC® HTB-35™ ...
-
bioRxiv - Cancer Biology 2020Quote: ... recombinant Cas9 nuclease (IDT) and the 4D-Nucleofector (Lonza) as previously described (Wagenblast et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant insulin (20 μg/mL, Lonza, #BE03-033E20), human recombinant EGF (2 ng/mL ...
-
bioRxiv - Immunology 2022Quote: ... Co-cultures were done in IMDM supplemented with 5% HI-HS (Lonza) and gentamycin (86 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: U2OS cells stably expressing GFP-tagged paxillin were cultured in phenol-red free DMEM (Lonza) at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The recombinant plasmid was transfected into HT29 cells using 4D-Nucleofecor (Lonza).
-
bioRxiv - Biophysics 2020Quote: ... hydrocortisone and recombinant human epidermal growth factor (MEGM Bullet Kit CC-4136; Lonza). Cells were maintained in an incubator under standard conditions (36.5 °C ...
-
bioRxiv - Microbiology 2021Quote: ... were electroporated with 1 μg of Ssp1-linearized pcDNA4/TO Strep- tagged ADAP1 or GFP vector using Nucleofector2b (Lonza). Positive clones were selected with 10 μg/mL Blasticidin and 100 μg/mL Zeocin ...
-
bioRxiv - Bioengineering 2023Quote: The PyroGene Recombinant Factor C Endpoint Fluorescent Assay (Lonza, Walkersville, MD, cat # 50-658U) was performed as recommended ...
-
bioRxiv - Molecular Biology 2020Quote: ... MBP-tagged TRIM21 (pFastBac-MBP-TRIM21) was expressed in SF9 insect cells in Lonza Insect-XPRESS according to standard protocols (Lonza). Cleared cell lysates were prepared by sonication of cell pellets in 50 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2000 p mol of a degron-tagged control protein (mTagBFP2-RxxG) in a 100 µl nucleofection reaction (4D nucleofector kit SE plus supplement SF1, Lonza) 14 hours following nucleofection ...
-
bioRxiv - Immunology 2022Quote: ... Absence of endotoxins (< 1EU/mL) was confirmed using the PyroGene™ Recombinant Factor C Assay (Lonza) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 100 μg/ml streptomycin and 15 ng/ml recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA and recombinant CAS9 were delivered as ribonucleoprotein (RNP) complexes using a 4D-Nucleofector X-Unit (Lonza). Briefly ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant plasmids were verified by Sanger sequencing and electroporated into E14 cells using the Nucleofector II platform (Lonza) (program A-013) ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg ml−1 streptomycin and 15 ng ml−1 recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the mouse ES cell nucleofection kit (Lonza) using protocol “A24” ...
-
bioRxiv - Bioengineering 2023Quote: Mouse C57 Cortex Neurons (Lonza, M-CX-300) were cultured in Primary Neuron Basal Medium (PNBM ...
-
bioRxiv - Immunology 2023Quote: ... X-Unit (Lonza, program: unstimulated mouse T cells). Cells were washed immediately after nucleofection to remove nucleofection reagents and improve survival.
-
bioRxiv - Neuroscience 2024Quote: ... and mouse neuron nucleofectorTM kit (VPG-1001, Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Systems Biology 2024Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Cancer Biology 2021Quote: ... expressing Cas9 and sgRNA targeting mouse p53 and pmaxGFP plasmid (Lonza). Similarly ...
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Developmental Biology 2019Quote: ... Nucleofection was performed with the Nucleofector Kit for mouse ESC (Lonza), using 2.5 μg of DNA and the Amaxa A-013 program ...
-
bioRxiv - Cell Biology 2024Quote: ... The Amaxa Mouse Macrophage Nucleofector Kit was from Lonza (Cologne, Germany). Gene-specific TaqMan primer-probe mixes used for quantitative real-time polymerase chain reaction (PCR ...
-
bioRxiv - Immunology 2024Quote: ... using the Amaxa Mouse Dendritic Cell Nucleofector Kit (#VPA-1011, Lonza) as previously described (12 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transfected using the Mouse ES Cell Nucleofector Kit (Lonza) and Amaxa Nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: NPCs were collected in nucleofection solution (Amaxa Mouse NSC Nucleofector Kit, Lonza) and electroporated with 5e6 or 1e6 copies/cell of 5’ biotinylated 145bp AAV ITR ssDNA or scrambled control (ITR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse endothelial cells from brain microvessels (bEND3) were maintained in DMEM (Lonza) supplemented with 10% decomplemented FBS (Lonza) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the Mouse ES cell Nucleofector kit (Lonza, Cat No. VPH-1001). 36 hours after transfection the cells were selected by 2μg/ml puromycin for 48 hours ...
-
bioRxiv - Cancer Biology 2022Quote: Primary mouse embryonic fibroblasts (MEFs) were purchased from Lonza (M-FB-481). They were expanded in Advanced DMEM supplemented with 15% fetal bovine serum ...
-
bioRxiv - Bioengineering 2023Quote: ... hepatocytes were electroporated using 100 µL Mouse/Rat Hepatocyte Nucleofector solution (Lonza) and conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... and the mouse neuron Nucleofector® Kit (Cat Number: VPG-1003, Lonza), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Cell pellets were resuspended in nucleofector buffer (Amaxa Mouse Macrophage Nucleofector Kit (Lonza)) and 2ug of siRNA was added to each tube (Dharmacon) ...
-
bioRxiv - Developmental Biology 2020Quote: ... ESCs were electroporated using Nucleofector II (Amaxa) and mouse ESC Nucleofector kit (Lonza). Afterwards ...