Labshake search
Citations for Lonza :
251 - 300 of 1681 citations for Rat Large Proline Rich Protein BAG6 BAG6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cultures were tested regularly with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and gentamicin/amphotericin (Single Quots® kit, CC‒4127, Lonza), pH 7.40 ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Cancer Biology 2023Quote: ... UWB1.289PT in the 50% RPMI-1640 (Gibco™)/ 50% MEGM (MEGM Bullet Kit; CC-3150, Lonza, Basel, Switzerland) supplemented with 3% FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... and supplemented with EGM-2 bullet kit (Lonza, CC-3162). HUVEC were seeded on 0.5% gelatin-coated 6-well plates at a density of 1.5 x105 cells/well overnight ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected using P3 Primary cell 4D-nucleofection kit (Lonza) and DN100 pulse on 4D nucleofector X unit (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were screened for mycoplasma with MycoAlert detection kit (Lonza) at receipt or thaw ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured in a supplemented (EGM-2 bullet kit, Lonza) endothelial cell growth medium (Lifeline Cell Technology ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with the P3 Primary Cell Buffer Kit (Lonza). Per sample ...
-
bioRxiv - Genetics 2024Quote: ... and SF Cell Line 4D X Kit (Lonza, #V4XC-2024) were employed ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Immunology 2023Quote: ... The levels of endotoxin in the purified protein samples were assessed using the QCL-1000 Limulus amebocyte lysate system (Lonza, Basel, Switzerland), and it was found that the recombinant proteins had endotoxin levels of ∼ 4 pg/µg ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit (Lonza) on a 4D Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... with the Amaxa P3 Primary Cell 4D Nucleofector X Kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Genomics 2021Quote: ... supplemented with BEGM Bronchial Epithelial SingleQuots Kit (excluding GA-1000, Lonza), 10% fetal bovine serum ...
-
bioRxiv - Immunology 2021Quote: ... and SE Cell Line 4D Nucleofector X kit (Lonza, Basel, Switzerland). Each cuvette had 4 μg of DNA and 107 CHOZN cells concentrated in SE cell solution ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cell lines were monthly checked for Mycoplasma contaminations (LONZA – MYCOALERT KIT), and all samples analyzed in this study were not contaminated ...
-
bioRxiv - Molecular Biology 2020Quote: ... using an Amaxa Nucleofector 2b device and ES nucleofection kit (Lonza) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Transient siRNA transfections were performed using Amaxa kits C (Amaxa Lonza) for CEM.NKR-CCR5 cells ...
-
bioRxiv - Microbiology 2019Quote: ... and the P3 Primary cell 4D Nucleofector X Kit L (Lonza)(20) ...
-
bioRxiv - Microbiology 2021Quote: ... and Vero cells were tested for mycoplasma (Lonza MycoAlert detection kit) and human cell line identity was authenticated by ATCC ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Biochemistry 2020Quote: ... Cells are monthly checked for mycoplasma contamination (MycoAlert detection kit, Lonza).
-
bioRxiv - Microbiology 2020Quote: ... Cells were tested monthly for mycoplasma MycoAlert Mycoplasma detection kit (Lonza) and treated with Mycoplasma Removal Agent (MP Biomedical ...
-
bioRxiv - Cell Biology 2021Quote: ... or Amaxa cell line nucleofection kit V (Lonza, Cat#VCA-1003).
-
bioRxiv - Microbiology 2021Quote: ... HT1080 cells were transfected using Amaxa Nucleofector Kit T (Lonza #VCA1003). For each transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were routinely tested for mycoplasma contamination using MycoAlert Kit (Lonza). Cells were dissociated into small aggregates using ReLeSR (STEMCELL technologies ...
-
bioRxiv - Microbiology 2020Quote: ... and the P3 Primary cell 4D Nucleofector X Kit L (Lonza) and program FP158 (Moon ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza), (program CA-137 ...
-
bioRxiv - Cell Biology 2021Quote: ... and resuspended in complete Nucleofector Kit C (Lonza Biosciences VCA-1004) media (106 cells per transfection ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline cell technology ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MycoAlert PLUS Mycoplasma Detection Kit was purchased from Lonza (Basel, Switzerland). Label IT® plasmid delivery control ...
-
bioRxiv - Zoology 2019Quote: ... and the SF Cell Line 4D-Nucleofector X Kit (Lonza GmbH) using 80-90% confluent cells after dissociation by trypsinization ...
-
bioRxiv - Microbiology 2019Quote: ... Transfection was performed by Nucleofection (Kit V4XP-2024, Lonza, Basel, Switzerland). 48 hours after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell lines were routinely checked for mycoplasma using MycoAlert kit (Lonza). The virus strains used in this study were recombinant VSV-GFP44 ...
-
bioRxiv - Systems Biology 2019Quote: ... We tested the cells with MycoAlert PKUS mycoplasma detection kit (Lonza) and ensured that they were free of mycoplasma infection ...