Labshake search
Citations for Lonza :
201 - 250 of 1787 citations for Rat Insulin Like 3 INSL3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2020Quote: ... The MycoAlert Mycoplasma Detection Kit (Lonza) was used to monitor mycoplasma contamination on a regular basis.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... MycoAlert Mycoplasma Detection Kit (Lonza, Bioscience). Each cell lines were used within passage 4/5 since their thawing from originally frozen vials.
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing (MycoAlert Detection Kit, Lonza) was performed monthly.
-
bioRxiv - Cell Biology 2022Quote: ... using MycoAlert detection kit (Lonza, LT07). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... Regular testing with MycoAlert kit (Lonza) confirmed the absence of mycoplasma contamination ...
-
bioRxiv - Cancer Biology 2020Quote: ... using MycoAlert™ kit (Lonza, Germany) and genetically authenticated using a STR-PCR fragments kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... Kit T solution (Lonza, Basel, Switzerland), and programs G-016 ...
-
bioRxiv - Cell Biology 2019Quote: ... and MF 1 Nucleofector kit (Lonza) according to the manufactures protocols ...
-
bioRxiv - Immunology 2021Quote: ... Nucleofector Kit V was from Lonza. The original vector pCasper-GR (#FP971 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with the SingleQuots kit (Lonza), 5 μg/ml transferrin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... Nucleofector Kit V (Lonza, VCA-1003); paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2023Quote: ... with the full growth kit (Lonza) and passaged using TrypLE Express.
-
bioRxiv - Molecular Biology 2023Quote: ... Mycoplasma detection kit (Lonza #LT07-318) was used as per the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... and verified mycoplasma free by Lonza MycoAlert mycoplasma detection kit (LT07, Lonza). Fibroblasts were synchronized by temperature cycles of 12 h 32°C followed by 12 h 37°C for 5 days ...
-
bioRxiv - Cancer Biology 2023Quote: Cell□line□specific Nucleofector Kits (Lonza) were used for transfections which were performed according to manufacturer’s protocol on a Nucleofector® 2b Device (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... using MycoAlert detection kit (Lonza, LT07). For co-immunoprecipitation experiments ...
-
bioRxiv - Microbiology 2024Quote: Toxilight Bioassay Kit (Lonza, LT17-127) or LDH-Glo Cytotoxicity Assay (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were regularly checked for mycoplasma contamination using a luminescence-based kit (Lonza, MycoAlertTM Mycoplasma Detection Kit).
-
bioRxiv - Bioengineering 2024Quote: ... Electroporation kit V and Electroporation kits for Primary T-Cell/HSPC were purchased from Lonza (Basel, Switzerland) and used on the Lonza Nucleofector 2b system ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Cancer Biology 2020Quote: ... dissociated into single cell suspension with trypsin-EDTA (Pan-Biotech, Germany) for 3 min followed by trypsin neutralizing solution (Lonza, Germany). Single cell suspensions of secondary mammospheres were obtained as described for day 7-first generation mammospheres.
-
bioRxiv - Microbiology 2021Quote: ... Vero cell cultures were seeded at 1-3 × 104 cells/cm2 in Dulbecco’s minimal essential medium (DMEM, LONZA, Alpharetta, GA, USA) supplemented with 9% foetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Synthetic Biology 2019Quote: ... using the SF Cell Line 4D-Nucleofector® × Kit L or × Kit S (Lonza, V4XC-2024, V4XC-2032) with the program CQ-104 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using SF Cell line 4D-Nucleofector X Kit L or X Kit S (Lonza, V4XC-2024, V4XC-2032) with the program CQ-104 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Kit S (both from Lonza, Basel, Switzerland). HDR was stimulated by HDR enhancer (IDT ...
-
bioRxiv - Bioengineering 2021Quote: ... and EGM-2 SingleQuot bullet kit (Lonza). For imaging experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and the Human Monocyte Nucleofector Kit (Lonza) as previously described (Schnoor et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with EGM-2 SingleQuot Kit (Lonza). HPAEC were cultured in multi-well cell culture plates and flasks coated with 0.1 % gelatin ...
-
bioRxiv - Immunology 2022Quote: ... Vienna) were electroporated (Nucleofector Kit; Lonza, Switzerland) with two Cas9/sgRNA vectors encoding GFP as a marker and the targeting DNA template containing the miRNA cluster flanked by loxP sites ...
-
bioRxiv - Genomics 2019Quote: ... and Basic NucleofectorTM Kit (Lonza, VPI-1002), and the electroporation program was U-023 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or using an Amaxa nucleofector kit (Lonza) for transfection of plasmids into THP-1 and RAW264.7 cells ...
-
bioRxiv - Microbiology 2021Quote: ... with additives (MEGM kit, Lonza CC-3150) with 100 ng/mL cholera toxin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with EBM-2 bullet kit (Lonza). Human pulmonary EC line ST1.6R48 was provided by Ronald E ...
-
bioRxiv - Immunology 2021Quote: ... Amaxa nucleofector kit C (Lonza, Basel, Switzerland) designed for nucleofection of T2 cells was used ...