Labshake search
Citations for Lonza :
251 - 300 of 310 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Percoll-purified (82) late-schizont-stage parasites were transfected with 50 µg of plasmid DNA using Amaxa Nucleofector 2b (Lonza, Switzerland) as previously described(83) ...
-
bioRxiv - Neuroscience 2020Quote: Primary rat hippocampal neurons were prepared as described previously39) Cultured neurons were transfected with pCAG-FR-GECO1a and pCAG-FR-GECO1c plasmids using electroporation (Lonza Nucleofector) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transient transfection of pp150 in HFF was performed by transfecting pp150 expressing plasmid (kindly provided by Edward Mocarski) using Amaxa Nucleofection kit V (Lonza inc.). The pp71-expressing plasmid (pCGN-pp71 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... E14 cells (5 × 106) were transfected with 10 μg of the appropriate plasmid with the Mouse ES Cell Nucleofector™ Kit (Lonza) and allowed to grow for 48h after transfection ...
-
bioRxiv - Biophysics 2019Quote: The HEK293 adherent culture cells were transfected with pcDNA3.4-PCV2d plasmid using Amaxa Nucleofector II instrument by Lonza (program A-23). The transfected cell were plated on 6-well plate ...
-
bioRxiv - Neuroscience 2019Quote: ... or a non-silencing plasmid immediately before plating (Amaxa™ P3 Primary Cell 4D-Nucleofector X Kit L; Lonza, CU133 program). The generation and knockdown efficiencies of shRNA plasmids were described previously (Guner et al. ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to a density of 1×106 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Genomics 2022Quote: ... We used 1.0 × 106 HCT116 or U2OS cells to transfect the base editor plasmids (2600 ng) using SE solution and 4D-nucleofector (Lonza, Switzerland) as per the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2022Quote: Bulk electroporations were performed with endotoxin-free plasmid preparations (>0.9 μg/μl) using the Y-unit of the 4D-Nucleofector® (Lonza Bioscience), both HcKCR1 and WiChR were subcloned into a pAAV-backbone and expressed as fusion proteins tagged with a fluorophore under a human syn1 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... Percoll-purified (70) parasites at late schizont stage were transfected with 50 μg plasmid DNA using Amaxa Nucleofector 2b (Lonza, Switzerland) as previously described (78) ...
-
bioRxiv - Cell Biology 2023Quote: ... Percoll-purified [131] parasites at late schizont stage were transfected with 50 µg plasmid DNA using Amaxa Nucleofector 2b (Lonza, Switzerland) as previously described [135] ...
-
bioRxiv - Physiology 2024Quote: The gRNA plasmid (1µg) and donor template plasmid (3µg) were introduced into 3T3-L1 cells (1X 10 6 cell) by electroporation (LONZA, Basel, Switzerland). After 48h of electroporation ...
-
bioRxiv - Cell Biology 2023Quote: ... brucei 13-90 cells were electroporated with 10 µg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (program X-001) (Lonza, Switzerland).
-
bioRxiv - Immunology 2024Quote: ... JurkatE6-1 cells and CD3+ T cells isolated from tumors or PBMCs were transfected with the OSA plasmid using the preset program DS104 of the 4D-Nucleofector™ system (Lonza). Electroporation was performed following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Cell Biology 2020Quote: 1 million Jurkat cells were electroporated with the 2.5 μg of sgRNA plasmid and GFP control plasmid at a 10:1 ratio using an Amaxa Cell Line Nucleofector Kit V and an Amaxa™ Nucleofector™ II (Lonza). HeLa ...
-
bioRxiv - Microbiology 2021Quote: ... Excysted sporozoites were resuspended in transfection buffer supplemented with a total of 100 µg DNA (comprised of 50 µg of Cas9/gRNA plasmid and 50 µg of repair template generated by PCR) and nucleofected using an Amaxa 4D nucleofector (Lonza, Basel, Switzerland). Transfected parasites were resuspended in PBS and administered to Ifng-/- mice ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... These plasmids were transfected into NHDFs and 7SPs by electroporation using the Amaxa nucleofector kit and nucleofector 2b (Lonza, Walkersvill, MD, USA). Two days later ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2022Quote: ... 8 million cells were transfected with 20ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit V (Lonza), program X-001 ...
-
bioRxiv - Genomics 2022Quote: ... 5 million cells were transfected with 10ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit T (Lonza), program X-001 ...
-
bioRxiv - Microbiology 2022Quote: ... 1.2E6 BHK21 cells were nucleofected with 2 µg of Spike plasmid using an Amaxa Nucleofector II with cell line kit L (Lonza #VCA-1005) and program A-031 ...
-
bioRxiv - Microbiology 2022Quote: ... schizonts purified from an overnight culture of PbDiCre parasites were transfected with 5–10 µg of linearised plasmid by electroporation using the AMAXA Nucleofector device (Lonza, program U033), as previously described (Janse et al. ...
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and either the HSP-Luc or the NF-κB-HSP-Luc plasmids by nucleofection using Amaxa Nucleofector (Amaxa AG-Lonza, Cologne, Germany) as previously described 59 ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed 1x in RT PBS and transfected with ∼15μg of DNA plasmid using Amaxa nucleofector 2b (Lonza, program O-005). After transfection ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... plasmids pSpCas9n(BB)-ZEB2-Guide-A &-B (0.5 µg of each plasmid) were electroporated into 1×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation ...
-
bioRxiv - Biochemistry 2021Quote: ... 105 cells were mixed with a plasmid vector (AsCas12a, n-SpCas9 (D10A, H840A)) and 20 μl of electroporation buffer (Lonza, V4XC-2032) and were nucleofected according to the manufacturer’s instructions (program ...
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Genetics 2020Quote: ... PFFs were co-electroporated with a circular transposase plasmid pCMV-hyPBase and a circular mPSP-PXAT plasmid using the program A-033 on the Nucleofector 2b Device (Amaxa Biosystems/Lonza, Cologne, Germany). After cell attachment ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Immunology 2022Quote: 1 × 105 HLFs were mixed with 2 μg of 100 μg/ml of the above expression plasmids in 100 μl PBS (GE Lifesciences, Marlborough, MA) and were transfected by electroporation using a 4D-Nucleofector System (Lonza, Walkersville, MD) following the manufacturer’s protocol CZ-167 ...
-
bioRxiv - Systems Biology 2022Quote: ... The PGK reporter cell line was generated by electroporation of K562 cells with 0.5 ug each of plasmids encoding the AAVS1 TALENs and 1 ug of donor reporter plasmid using program T-016 on the Nucleofector 2b (Lonza, AAB-1001). Cells were treated with 0.5 ug/mL puromycin for one week to enrich for successful integrants ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells generated by transfection with pcDNA3 plasmid containing wild-type BRCA1 (27) were both grown in 50% RPMI-1640 and 50% Mammary Epithelial Growth Medium (Lonza, Basel, Switzerland). Medium for UWB+ B1 cells was supplemented with 200 μg/ ml G418 S (Merck ...
-
bioRxiv - Immunology 2023Quote: ... Then sporozoites were resuspended in transfection buffer supplemented with 100 μg DNA (comprising 50 μg of Cas9/gRNA plasmid and 50 μg of repair template) and electroporated using an Amaxa 4D nucleofector (Lonza, Basel, Switzerland). Parasites carrying a stable transgene were selected using paromomycin added to the drinking water of infected mice ...
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...