Labshake search
Citations for Lonza :
151 - 200 of 2520 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Purified DNA was separated on a 3% NuSieve GTG agarose gel (Lonza #50081). The gel band corresponding to the size of dinucleosomal DNA (∼250 to 350bp ...
-
bioRxiv - Bioengineering 2021Quote: ... Erythrocytes were lysed for 3 min on ice in ACK lysing buffer (Lonza), stained with biotinylated lineage antibodies against CD3ε (145-2C11) ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged every 3-4 days with Accutase (Lonza, Basel, Switzerland) and seeded on new plates with density 1:5 – 1:10 in iPS medium with ROCK inhibitor Y-27632 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Immunology 2022Quote: ... 1 x 10^6 purified naive T-cells were resuspended in 15µL buffer P3 + 5µL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7µL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Microbiology 2020Quote: ... 1 million Jurkat T-cells were resuspended in 100 μL Nucleofector solution (Cell Line Nucleofector™ Kits, Lonza) and combined with 2 μg of the linearized dual-fluorophore vector and 2 μg of the corresponding gRNA/Cas9 plasmid ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... This mixture was transferred into one well of a Nucleocuvette™ Plate (Lonza) and electroporated using manufacturer’s recommended protocols (except for HEK293 ...
-
bioRxiv - Immunology 2020Quote: ... This mixture was transferred into one well of a Nucleocuvette™ plate (Lonza) and electroporated using protocol 96-DS-150 ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to a 96 well plate and washed with HBSS (Lonza # 10-527F) with 0.1% BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... and maintained on collagen-coated plates using Hepatocyte Basal Medium (Lonza, CC-3197) with dexamethasone and insulin (each 0.1 μM ...
-
bioRxiv - Microbiology 2023Quote: ... transferred to a 96 well plate and washed with HBSS (Lonza # 10-527F) with 0.1% BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... on 0.2% gelatin-coated plates with EGM-2 bulletkit medium (Lonza, Basel, Switzerland), containing EBM-2 basal medium along with the EGM-2 singlequots kit components ...
-
bioRxiv - Immunology 2024Quote: ... Keratinocytes were lifted off the plate using Trypsin/EDTA (Lonza, Cat: LONCC-5012) for 5min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sorted cells were plated in round bottom plates in X-Vivo15 media (Lonza) supplemented with 50 μM 2-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2019Quote: ... sgRNANPM1 and sgRNAALK (3 µg each) (Amaxa Lonza 4D program EA-104 P3 solution). siRNA inhibition was analyzed by Western blot at the time of the second transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... Calu-3 cells were maintained in EMEM (with EBSS and L-glutamine, BioWhittaker, Lonza) supplemented with 20% FBS (heat-inactivated ...
-
bioRxiv - Bioengineering 2022Quote: ... Human umbilical vein endothelial cells (HUVECS; C2519A) were cultured in EGM-3 medium (Lonza) and were used passages 2-3 for organoids fabrication ...
-
bioRxiv - Developmental Biology 2022Quote: A single cut in the NKX2.2 3’UTR was made using transient transfection (Lonza Human Stem Cell Nucleofector Kit VPH-5012 ...
-
bioRxiv - Immunology 2023Quote: ... The remaining erythrocytes were lysed with 3 mL ACK lysing buffer (Lonza, Basel, Switzerland) for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dinucleosomes were purified and excised from a 3% NuSieve GTG agarose gel (Lonza #50081) using Zymoclean Gel DNA Recovery Kit (Zymo #D4008) ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 × 105 cells were co-transfected with 3 µg plasmid-sgRNA construct and ssODN (0.6 µM final concentration) with Amaxa Human Stem Cell Nucleofector Kit 1 (Lonza) and program A-023 for the Amaxa Nucleofector Device II ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... Cells were transfected with 250 nM of siRNA and 1 μl of control pMax GFP (Nucleofector X kit, Lonza), using the CU-133 program ...
-
bioRxiv - Cell Biology 2022Quote: ... OCI-LY-1 cells were transfected using the Amaxa® Cell Line Nucleofector® Kit L (Lonza, Basel, Switzerland), program C-05 as previously described(46) ...
-
bioRxiv - Neuroscience 2023Quote: Electroporation with freshly assembled RNP complex was performed on hiPSCs using the Human Stem Cell Nucleofector Kit 1 (Lonza) in conjunction with the Amaxa Nucleofector 2b system (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... with two phosphothiorate linkages on each end were mixed with 82 µL Nucleofector Solution V and 18 µL of Supplement Solution 1 according to manufacturer’s recommendations for the Cell Line Nucleofector Kit V (Lonza). 5×105 U2OS.EGFP parent cells were resuspended in the above mixture and nucleofected with a Lonza Nucleofector 2b Device (Kit V ...
-
bioRxiv - Immunology 2020Quote: ... pre-coated TC plate and cultured with Small Airway Epithelial Cell Growth Medium (Lonza) supplemented with charcoal-stripped 5% FBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Efflux experiments were performed in 6-well plates in 2.5 ml Pro293a medium (Lonza) supplemented with 2 mM L-glutamine and 100 units pen/strep per ml.
-
bioRxiv - Microbiology 2020Quote: ... the RNP complexes were added to 1×105 cells in 40 μl of P3 nucleofection buffer from the 4D-Nucleofector X kit (Lonza). Half of the mixture was loaded to each well of a 16-well nucleofection cassette and nucleofected using the using E0-100 program with the 4D-Nucleofector Lonza Amaxa ...
-
bioRxiv - Genomics 2020Quote: ... Transfection of these iPSCs with the plasmid and Super piggyBacTM transposase mRNA (Transposagen) was done using the Human Stem Cell Nucleofector Kit 1 (VAPH-5012) by Nucleofector 2b Device (AAB-1001, Lonza) according to the manual ...
-
bioRxiv - Immunology 2021Quote: Control or transfected Lymphocytes (with Flag-wt-TDP-43 or Flag-NLS-mut-TDP-43 plasmid (1 μg) using nucleofection kit (Lonza)) were placed on coverslips (2 x 106 cells in sterile glass coverslips-Ø 12 mm ...
-
bioRxiv - Genomics 2020Quote: 5 × 105 THP-1 cells were resuspended in 20µL nucleofection solution (16.4µL SG nucleofector solution + 3.6µL supplement 1) from the SG Cell Line 4D-Nucleofector™ X kit (Lonza, V4XC-3032). 300pmol PPP2R1A sgRNA (Synthego ...
-
bioRxiv - Cell Biology 2021Quote: ... Patients-derived iPS cells were electroporated with plasmids and single stranded DNA donor oligos using Human Stem Cell NucleofectorTM Kit 1 (Lonza). After 36 hours ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Microbiology 2022Quote: ... Ribonucleoproteins were introduced into 1 × 106 sub-confluent BlaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cell Biology 2022Quote: ... and a gene-edited iPSC homozygous MYBPC3 knock-out (MYBPC3 (-/-)) (Supplemental Table 1).(15–17) iPSCs were verified to be free of mycoplasma contamination using MycoAlert Detection Kit (Lonza). Newly generated lines were karyotyped (WiCell Institute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...