Labshake search
Citations for Lonza :
301 - 350 of 505 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The bone marrow was re-suspended in ACK lysis buffer (Lonza, LZ10-548E; Basel, Switzerland) to lyse the red blood cells ...
-
bioRxiv - Bioengineering 2024Quote: ... T cell pellets were resuspended in 20 uL per editing condition in P3 Buffer (Lonza) and then mixed with prepared RNP and DNA HDRT templates ...
-
bioRxiv - Genetics 2023Quote: ... Cell pellets were carefully resuspended in 300 uL of ACK lysis buffer (Lonza # BP10-548E) for 1 minute in ice ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA constructs in TE buffer were mixed with 90µl P3 Primary cell solution (Lonza) and used to resuspend 20µl segmented schizonts which were subsequently transferred to a transfection cuvette ...
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were regularly tested for mycoplasma contamination by PCR and MycoAlert Mycoplasma Detection Kit (Lonza). Avapritinib and MK-1775 were obtained from Selleckchem (Houston ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Cancer Biology 2022Quote: ... and red blood cell lysis was achieved with an ACK (Ammonium-Chloride-Potassium) lysing buffer (Lonza). Cells were washed with PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 2a) per 0.5 million cells that were washed with DPBS and suspended in R Buffer (Lonza). After optimization ...
-
bioRxiv - Immunology 2021Quote: ... and mixed with the RNP complexes and 4uM Electroporation Enhancer in P4 Primary Cell buffer (Lonza), transferred the cell/CRISPR mixture to the bottom hole of the wells of the Lonza nucleofector strip for electroporation by using Lonza nucleofector (Program CM137) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The resultant cell suspension of NPCs was incubated for 30 sec with ACK lysis buffer (Lonza) to deplete red blood cells ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... Cells were then washed with CyFACS buffer and incubated for 5min at RT in 1xPBS (Lonza) with 1/1000 diluted cisplatin (Fluidigm) ...
-
bioRxiv - Immunology 2019Quote: ... resuspended in 20µl P3 buffer (P3 primary cell 4D-Nucleofector™ X Kit S, Lonza Ltd), and mixed with the pre-prepared 5 µl sgRNA/Cas9 RNP prior to immediate electroporation using the P3 primary cell 4D-Nucleofector™ X Kit S electroporation wells and Lonza 4D-Nucleofector™ System (Pulse DN 100) ...
-
bioRxiv - Immunology 2020Quote: ... Leukocytes were washed thoroughly in PBS buffer (without Ca+2 and Mg+2) (Lonza, Walkersville, MD) and cell viabilities were assessed using trypan blue exclusion ...
-
bioRxiv - Immunology 2021Quote: ... Isolated neutrophils were cleared off residual red blood cells by ACK lysis buffer (10-548E, Lonza) and resuspended in mHBSS buffer (20mM HEPES ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hank’s Balanced Salt Solution (HBSS) Buffer with or without phenol red was from Lonza (Walkersville, MD). Protease Inhibitor Cocktail was from Promega (Madison ...
-
bioRxiv - Immunology 2022Quote: ... blood was collected in microtubes with EDTA to prevent coagulation and treated with ACK buffer (Lonza) to lyse red-blood cells ...
-
bioRxiv - Bioengineering 2022Quote: ... 20 μL of T cells were resuspended in P3 buffer at 5 × 107 cells/mL (Lonza) and added to the electroporation mixture ...
-
bioRxiv - Neuroscience 2023Quote: ... and the cell pellet resuspended in 2 ml of ACK lysing buffer (Lonza, Cat# 10-548E). After centrifugation ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then washed twice with R10 media and resuspended in ACK Lysis Buffer (Lonza Biosciences) if necessary ...
-
bioRxiv - Immunology 2023Quote: ... and red blood cells co-sedimented with the IHICs were lysed using ACK lysis buffer (Lonza) for 5 minutes ...
-
bioRxiv - Immunology 2023Quote: ... 2 samples of 5x106 PBMCs were nucleofected in 100 mL of P3 buffer (Lonza; V4XP-3024) with 125 pmol of Alt-R Sp HiFi Cas 9 nuclease v3 (IDT ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or BAFF-R (transposon, pCMV-hyPBase, SF buffer kit V4XC-2032, Lonza 4D Nucleofector, code DA100). CD79b1 refers to a chimeric protein comprising mouse CD79b extracellular domain with a CD28TM and truncated CD3ζΔ to promote surface expression in the absence of CD79a ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell pellets were resuspended in two to three volumes of ACK lysis buffer (Lonza: #10-548E) according to the manufacturers’ specifications ...
-
bioRxiv - Immunology 2024Quote: ... using standard procedures including red blood cell lysis with ACK lysis buffer (Lonza by Thermo Fisher). Before cell staining ...
-
bioRxiv - Microbiology 2024Quote: ... and the pellet was resuspended in 20 µL of supplemented room-temperature P3 electroporation buffer (Lonza) per reaction ...
-
bioRxiv - Pathology 2024Quote: ... passed through a 30 µm cell strainer and erythrocytes were lysed using ACK lysis buffer (Lonza). For analysis of DiD-loaded NPs internalization ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3ug of purified EVs were electroporated in 20μL of SF buffer (#V4XC-2032, Lonza, Basel, Switzerland) with 0.4μg of CRE-expressing plasmid (Addgene #172433 ...
-
bioRxiv - Immunology 2024Quote: ... an electroporation reaction consisted of 2 × 105 HEK293T cells in 20 μL of SF buffer (Lonza) and 2 μL of 20 μM Cas9 RNP (equivalent to 40 pmol final concentration) ...
-
bioRxiv - Genomics 2021Quote: ... PBMCs were then treated with 2 ml of erythrocytes lysis buffer (Lonza Walkersville inc. #120-02-070) for 1 min ...
-
bioRxiv - Neuroscience 2020Quote: The dissociated sensory neuron pellet was resuspended with 98 µL electroporation buffer (Mouse neuron nucleofector kit, Lonza) mixed with RNA oligos (0.2 nmol per transfection ...
-
bioRxiv - Biophysics 2021Quote: ... a 50 µL cell pellet was mixed with 100 µL electroporation buffer (SF cell line solution, Lonza) containing AMUPol and electroporated (HEK293 pulse sequence ...
-
bioRxiv - Genetics 2020Quote: ... and cells were resuspended in 20µL/reaction of room-temperature Lonza nucleofection buffer P2 (Lonza V4XP-2024). The cell suspension was gently mixed with 2.5µL/reaction of appropriate RNP and then pipetted into a 96-well-format nucleofection cuvette for the Lonza 4D X unit or Shuttle unit (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... Splenocyte suspension was spun down (1250 rpm, 5 min, 4C) and lysed in ACK Lysis buffer (Lonza) for 5 minutes on ice ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Physiology 2020Quote: ... 50μl of blood was lysed using 500μl of ACK (Ammonium-Chloride-Potassium) Lysing Buffer (Lonza, Walkersville, USA) 10 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet was resuspended in 20 µl of room temperature P3 electroporation buffer (Lonza, Basel, Switzerland) per reaction ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet was resuspended in 20 µL of room-temperature SE electroporation buffer plus supplement (Lonza) per reaction ...
-
bioRxiv - Immunology 2019Quote: ... T cells were centrifuged for 10 min at 90x g and resuspended in electroporation buffer P3 (Lonza) at a concentration of 750,000 cells/ 20 μL ...
-
bioRxiv - Biophysics 2019Quote: ... Approximately 1 to 1.5 × 106 hPSCs were washed in DPBS and resuspended in P3 primary buffer (Lonza) with 1 μg gRNA ...
-
bioRxiv - Immunology 2021Quote: ... 2 × 106 cells were suspended in 100 µL buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza), mixed with 4 µg DNA and transfected using the 4D-Nucleofector program DN-100 ...
-
bioRxiv - Immunology 2021Quote: ... Bone marrow was collected and red blood cells were lysed with ACK lysing buffer (Lonza, LZ10-548E). Cells were passed through a cell strainer (70 μm pore size ...
-
bioRxiv - Immunology 2021Quote: ... Afterwards, they were resuspended in 20 µl / 106 cells ice-cold electroporation buffer (1M, or P3 (Lonza) as indicated) ...
-
bioRxiv - Immunology 2021Quote: ... RNPs were electroporated immediately after complexing into Tregs and T cells resuspended in supplemented P3 buffer (Lonza).
-
bioRxiv - Molecular Biology 2022Quote: ... 1 × 105 to 2 × 105 cells were collected and resuspended in 15 µL of nucleofection buffer (Lonza). For each reaction ...
-
bioRxiv - Genomics 2023Quote: ... into 96-well plates containing 5 μl modified freeze buffer (0.1% NP-40, 7.5. % DMSO, 42.5 % 2X Profreeze-CDM (Lonza) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both bone marrow and mammary gland were treated with ACK Lysing Buffer (10-548E; Lonza, Basel, Switzerland) to lyse red blood cells ...
-
bioRxiv - Biophysics 2023Quote: ... a 50 µL cell pellet was mixed with 100 µL electroporation buffer (SF cell line solution, Lonza) containing AMUPol and electroporated (HEK293 pulse sequence ...
-
bioRxiv - Bioengineering 2024Quote: ... 2.5×105-1×106 CD34+ cells were resuspended in P3 buffer (Lonza, Basel, Switzerland, cat.: V4XP-3032) with complexed RNPs and electroporated using the Lonza 4D Nucleofector and 4D-Nucleofector X Unit (program DZ-100) ...
-
bioRxiv - Immunology 2023Quote: ... 1e6 T cells were resuspended in 20 µl P3 electroporation buffer with P3 supplement (Lonza. #V4XP-3032) as per manufacturer instructions and combined with 3 µl RNP ...