Labshake search
Citations for Lonza :
1 - 50 of 99 citations for Myelin Basic Protein Biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... and Basic NucleofectorTM Kit (Lonza, VPI-1002), and the electroporation program was U-023 ...
-
bioRxiv - Cell Biology 2022Quote: ... Basic Parasite NucleofectorTM Kit 2 was from Lonza. Inhibitors and drugs (etoposide ...
-
bioRxiv - Developmental Biology 2019Quote: ... HUVECs in basic EGM medium (EBM2 H3CC-3156, Lonza) were seeded in triplicate at a density of 12.5 x104 on Matrigel and incubated at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... resuspended in 25 μl Amaxa Basic Parasite Nucleofector solution (Lonza) and added to 10-20 μg DNA dissolved in 10 μl H2O ...
-
bioRxiv - Microbiology 2020Quote: ... resuspended in 25 μL Amaxa Basic Parasite Nucleofector solution (Lonza) and added to 10-20 μg DNA dissolved in 10 μl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended in 25 mL Amaxa Basic Parasite Nucleofector solution (Lonza) and added to 10 µg DNA dissolved in 10 µl H2O ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 25 µl Amaxa Basic Parasite Nucleofector solution (Lonza) and added to 10 µg DNA dissolved in 10 µl H2O ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 25 μL Amaxa Basic Parasite Nucleofector solution (Lonza) and added to 10-20 µg DNA dissolved in 10 µl H2O ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Basic Nucleofector Kit for primary neurons (Lonza, VAPI-1003) as described (Scholz et al. ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transfected by electroporation using Basic Primary Neurons Nucleofector Kit (Lonza), according to the manufacturer’s protocol and plated onto glass coverslips with mouse Laminin coating over PDL layer (Neuvitro) ...
-
bioRxiv - Microbiology 2022Quote: Transfection was performed using the Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine in their drinking water ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection experiments were performed using Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Amaxa Basic Nucleofector kit for primary mammalian SMCs (LONZA, Basel, Switzerland) using Nucleofector 2b device (LONZA ...
-
bioRxiv - Cell Biology 2022Quote: ... some cells were transfected by electroporation using Basic Primary Neurons Nucleofector Kit (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Basic Nucleofector Kit for Primary Mammalian Smooth Muscle Cells (VPI-1004, Lonza) and following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: To induce expression of fluorescently labeled proteins DCs were transfected according to manufacturer guidelines using nucleofector kit for primary T cells (Amaxa, Lonza Group). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 x 106 primary urine cells were reprogrammed using the Amaxa Basic Nucleofector Kit (Lonza) according to the protocol of the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected using transfection cuvettes supplied with the Basic Parasite Nucleofector Kit (Lonza transfection) or 2 mm BTX cuvettes (Tb-BSF transfection ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the standard LdBPK_282 cl4 using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were subsequently resuspended in 100 μL nucleofector solution of the Basic Parasite Nucleofector Kit 2 (Lonza), combined with 50 μL plasmid solution containing 5-10 μg DNA ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Neuroscience 2021Quote: ... counted and 2×106 cells were transfected using the Basic Nucleofector kit for primary neurons (VAPI-1003, Lonza) and the D-33 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 10 ng/mL basic fibroblast growth factor or MEGM™ culture medium (Lonza, cat. no. CC-3150), completed as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Neuroscience 2021Quote: ... the reaction was stopped by adding deactivated fetal calf serum (FCS; HyClone) and basic medium (1 % Penicillin/ Streptomycin (Lonza), 10 % FCS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8×107 promastigotes were transfected with 1 µg (≈ 1,68.1011 molecules) of the linearized barcoding library using the Basic Parasite Nucleofector™ kit 1 (Lonza) with the U-033 program ...
-
bioRxiv - Cancer Biology 2023Quote: ... hTERT ipn02.3 2λ cells were transfected by electroporation using the Amaxa Basic Nucleofector Kit for Primary Mammalian Fibroblasts (Lonza) and the program U-023 ...
-
bioRxiv - Molecular Biology 2024Quote: ... we modified the protocol and compared site-by-site the transfection efficiency of the Basic Parasite Nucleofector Kit (Lonza) and Tb-BSF protocol (Schumann Burkard et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two gRNA plasmids and pCas9 (D10)-GFP plasmid were nucleofected into cells using Basic Nucleofector Kit for Primary Mammalian Epithelial Cells (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2005) using Amaxa Basic Parasite Nucleofector Solution 1 using the X-001 program of an Amaxa Nucleofector II (Lonza, Switzerland). Clones were selected by growth in medium containing phleomycin (2.5 μg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... by nucleofection using the Basic Nucleofector Kit for Primary Mammalian Fibroblasts with programme A-24 according to the manufacturer’s instructions (Lonza, Cologne, Germany). Cell clones were isolated after approximately 12 days of puromycin selection (1.5 µg/mL) ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a total volume of 100μL/ reaction and electroporated using an Amaxa TM Basic Nucleofector TM Kit for Primary Mammalian Epithelial cells (Lonza, # VPI-1005) and the NucleofectorTM 2b Device (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... brucei 13-90 cells were electroporated with 10 µg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (program X-001) (Lonza, Switzerland).
-
bioRxiv - Cancer Biology 2020Quote: ... 10 mmol/L HEPES (PAA Laboratory) and 1 ng/mL human basic fibroblast growth factor (bFGF) (Sigma-Aldrich) (Lonza, Walkersville, MD, USA). The generation number of ECs is maintained between 30-40 generations ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... electroporated with 10 μg of linearised plasmid DNA or PCR product using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (Lonza, Switzerland, program X-001).
-
bioRxiv - Neuroscience 2021Quote: ... LUHMES cells were electroporated and transfected with 2 μg of plasmid using the Amaxa™ Basic Primary Neurons Nucleofector™ Kit and protocol (Lonza, cat. # VPI-1003). Transfected cells were selected by flow-sorting for DAPI negative ...
-
bioRxiv - Microbiology 2019Quote: ... 3 µl of the labeled culture was spotted on glass cover slide and covered with 1.5 % (w/v) SeaKem LE agarose (Lonza) pad in water and visualized by epifluorescence microscopy ...
-
bioRxiv - Genomics 2021Quote: ... 1.6×105 cells were suspended in P3 Primary Cell Solution with 50pmol Cas9 protein (St. Jude Protein Production Core) and 150pmol sgRNA (Synthego) with pMaxGFP plasmid at 200ng/ul (Lonza) in a total volume of 20ul with program DS130 ...
-
bioRxiv - Genomics 2021Quote: ... and 50 pmole of spCas9 protein (St. Jude Protein Production Core) with pMaxGFP plasmid as a transfection control at 200ng/ul (Lonza) using the 4D-Nucleofector™ X-unit (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were separated by SDS-PAGE using 14% Prosieve (Lonza) polyacrylamide gels and electroblotted to Immobilon-P membranes (Millipore) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with Cas9 ribonucleic protein (RNP) complexes in SF buffer (Lonza), using the pulse codes CM-150 or CV-104 ...
-
bioRxiv - Cancer Biology 2020Quote: ... consisting of 100 pmol of chemically modified sgRNA (Synthego) and 35 pmol of Cas9 protein (St. Jude Protein Production Core) via nucleofection (Lonza, 4D-Nucleofector™ X-unit) using solution P3 and program CA-137 in small cuvettes according to the manufacturers recommended protocol ...
-
bioRxiv - Microbiology 2020Quote: ... the medium was removed and replaced by Ultradoma Protein-Free (LONZA). The cultured medium was harvested and replenished on the second ...
-
bioRxiv - Genetics 2022Quote: ... membranes were stained with SYPRO-Ruby Protein Gel Stain (Lonza Rockland) to confirm equal loading ...
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Cell Biology 2023Quote: ... S2Xpress cells were cultured in Insect-XPRESSTM protein-free medium (LONZA, Belgium) supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin (GIBCO) ...
-
bioRxiv - Immunology 2023Quote: ... Protein expression was induced with 5µM CdCl2 in Insect-XPRESS medium (Lonza) for 5-7 days and supernatants were concentrated and purified using strep-tacting affinity chromatography columns in an AKTA FPLC system ...