Labshake search
Citations for Lonza :
1 - 50 of 1857 citations for Mouse WD repeat containing protein WRAP73 WRAP73 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... All cells were authenticated by short tandem repeat analysis and confirmed negative for Mycoplasma infection with the MycoAlert Mycoplasma Detection Kit (Lonza). HCT-116 and A549 cells were cultured in DMEM ...
-
bioRxiv - Systems Biology 2021Quote: ... All of the cell lines have been periodically subjected to re-confirmation by Short Tandem Repeat (STR) profiling by ATCC and mycoplasma testing by MycoAlertTM PLUS mycoplasma detection Kit (Lonza). A375 ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines have been periodically subjected to re-confirmation by Short Tandem Repeat (STR) profiling by ATCC and mycoplasma testing by MycoAlertTM PLUS mycoplasma detection Kit (Lonza). YUHEF ...
-
bioRxiv - Genomics 2023Quote: ... All cell lines were authenticated by short tandem repeat (STR) profiling and verified mycoplasma free using the MycoAlert PLUS Mycoplasma Detection kit (Lonza) prior to conducting experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were authenticated by Short Tandem Repeat analysis and tested for Mycoplasma contamination with a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely authenticated using short tandem repeat profiling and verified to be free of mycoplasma using the MycoAlert mycoplasma detection kit (Lonza Cat# LT07-418), by the QIMR Berghofer Medical Research Institute analytical facility (Brisbane ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cell line identities were confirmed by short tandem repeat profiling.77 Cell cultures were routinely tested for Mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza Bioscience, cat # LT07) according to manufacturer protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell line was authenticated through short tandem repeat analysis and tested for mycoplasma contamination every 10 passages using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). PDGFR-BiFC and myr-Venus stable cells were cultured in RPMI growth medium [RPMI 1640 (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines used in this study were authenticated using short tandem repeat genotyping (Labcorp) and confirmed to be negative for mycoplasma contamination using MycoAlertTM PLUS Assay (Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... All of the cell lines were confirmed by single-nucleotide-polymorphism array and short-tandem-repeat authentication (Genetica DNA Laboratories) and routinely tested negative for mycoplasma (MycoAlert, Lonza)
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the mouse ES cell nucleofection kit (Lonza) using protocol “A24” ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse neuron nucleofectorTM kit (VPG-1001, Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Developmental Biology 2019Quote: ... Nucleofection was performed with the Nucleofector Kit for mouse ESC (Lonza), using 2.5 μg of DNA and the Amaxa A-013 program ...
-
bioRxiv - Immunology 2024Quote: ... using the Amaxa Mouse Dendritic Cell Nucleofector Kit (#VPA-1011, Lonza) as previously described (12 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Amaxa Mouse Macrophage Nucleofector Kit was from Lonza (Cologne, Germany). Gene-specific TaqMan primer-probe mixes used for quantitative real-time polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transfected using the Mouse ES Cell Nucleofector Kit (Lonza) and Amaxa Nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: NPCs were collected in nucleofection solution (Amaxa Mouse NSC Nucleofector Kit, Lonza) and electroporated with 5e6 or 1e6 copies/cell of 5’ biotinylated 145bp AAV ITR ssDNA or scrambled control (ITR ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the Mouse ES cell Nucleofector kit (Lonza, Cat No. VPH-1001). 36 hours after transfection the cells were selected by 2μg/ml puromycin for 48 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... and the mouse neuron Nucleofector® Kit (Cat Number: VPG-1003, Lonza), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Cell pellets were resuspended in nucleofector buffer (Amaxa Mouse Macrophage Nucleofector Kit (Lonza)) and 2ug of siRNA was added to each tube (Dharmacon) ...
-
bioRxiv - Developmental Biology 2020Quote: ... ESCs were electroporated using Nucleofector II (Amaxa) and mouse ESC Nucleofector kit (Lonza). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with the Amaxa Mouse Neuron Nucleofector Kit (Lonza, VPG-1001) using the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Genetics 2023Quote: ... The Amaxa Mouse Embryonic Stem Cell Nucleofector Kit was used (Lonza, VPH-1001), program A-24 ...
-
bioRxiv - Genomics 2022Quote: ... Nucleofection solutions and cuvette were from Mouse ES Cell Nucleofector kit (Lonza, VPH-1001). Nucleofector (Lonza 2b ...
-
bioRxiv - Neuroscience 2021Quote: ... An Amaxa Nucleofector 2b Device and a Mouse Embryonic Fibroblast Nucleofector Kit 1 (Lonza) were used to transfect MEFs with βCTF-3xFLAG plasmid using program N-024 of the Nucleofector (Supplementary Figure 3).
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfections of primary cells were all performed with the Amaxa Mouse Neuron Nucleofector Kit (Lonza), using the O-005 nucleofection program ...
-
bioRxiv - Molecular Biology 2021Quote: Xist knockdown was performed following manufacturer’s instructions for the Mouse Neural Stem Cell Nucleofector Kit (Lonza). 3-5×106 NSCs were collected and resuspended in 70 μL Nucleofector solution ...
-
bioRxiv - Genetics 2021Quote: ... Transfection was carried out by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 2 days of transfection GFP expressing cells were FACS sorted and sparsely seeded for clonal expansion on 15cm plate ...
-
bioRxiv - Genomics 2021Quote: ... using a Nucleofector™ 2b device and the Mouse ES Cell Nucleofector Kit (Lonza, VAPH-1001) according to the manufacturer’s instructions and plated into two 10 cm dishes ...
-
bioRxiv - Genomics 2020Quote: ... containing 4uL 1X PBS (Lonza). The plates were centrifuged and immediately placed on dry ice ...
-
bioRxiv - Microbiology 2021Quote: ... containing 25 mM HEPES (Lonza), 2% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2022Quote: ... containing 1% Pen-Strep (Lonza). Cells were thawed in medium supplemented with 10% FBS (Sigma Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 10% FBS (Lonza, Switzerland) and 1X PenStrep (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... containing Neural Survival Factor (Lonza), N2 supplement (Invitrogen ...