Labshake search
Citations for Lonza :
1 - 50 of 2498 citations for Mouse Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... containing 1% Pen-Strep (Lonza). Cells were thawed in medium supplemented with 10% FBS (Sigma Life Sciences) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (Lonza) and macrophage media (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... An Amaxa Nucleofector 2b Device and a Mouse Embryonic Fibroblast Nucleofector Kit 1 (Lonza) were used to transfect MEFs with βCTF-3xFLAG plasmid using program N-024 of the Nucleofector (Supplementary Figure 3).
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the mouse ES cell nucleofection kit (Lonza) using protocol “A24” ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse neuron nucleofectorTM kit (VPG-1001, Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... Fresh substrate containing 1% agarose (SeaKem LE Agarose, Lonza), 0.8% acetic acid ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Microbiology 2022Quote: ... a fresh medium containing 1% SeaPlaque Agarose (Lonza, Cat# 50100) was layered and incubated at 32 or 37°C until plaque formation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Biophysics 2020Quote: ... or in Binding buffer (1% w/v BSA and 25 mM HEPES pH 7.2 in DMEM without phenol red; Lonza Netherlands B.V.) at 4°C in the case of HeLa cells ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Developmental Biology 2019Quote: ... Nucleofection was performed with the Nucleofector Kit for mouse ESC (Lonza), using 2.5 μg of DNA and the Amaxa A-013 program ...
-
bioRxiv - Cell Biology 2024Quote: ... The Amaxa Mouse Macrophage Nucleofector Kit was from Lonza (Cologne, Germany). Gene-specific TaqMan primer-probe mixes used for quantitative real-time polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Immunology 2024Quote: ... using the Amaxa Mouse Dendritic Cell Nucleofector Kit (#VPA-1011, Lonza) as previously described (12 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SH-SY5Y dopaminergic neuroblastoma cells were cultured in Dulbecco’s modified Eagle’s medium:F-12 (DMEM:F-12; 1:1) containing high glucose (3.151 g/L) (Lonza), supplemented with 10% (v/v ...
-
bioRxiv - Physiology 2020Quote: ... Digestion was stopped with 1 ml culture medium containing 80% DMEM (Lonza), 10% BCS (Hylcone) ...
-
bioRxiv - Immunology 2021Quote: ... 1.5×106 cells multiplied by the number of mice to be injected were transfected with the pIL-10 vector (1×106 cells/1.5 μg pIL-10 DNA per cuvette) using the Mouse T Cell Nucleofector Kit (Lonza, No: VPA-1006) with Nucleofector II Device (program X-100) ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transfected using the Mouse ES Cell Nucleofector Kit (Lonza) and Amaxa Nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: NPCs were collected in nucleofection solution (Amaxa Mouse NSC Nucleofector Kit, Lonza) and electroporated with 5e6 or 1e6 copies/cell of 5’ biotinylated 145bp AAV ITR ssDNA or scrambled control (ITR ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the Mouse ES cell Nucleofector kit (Lonza, Cat No. VPH-1001). 36 hours after transfection the cells were selected by 2μg/ml puromycin for 48 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... and the mouse neuron Nucleofector® Kit (Cat Number: VPG-1003, Lonza), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (EGM2 media without supplementation with EGF, FGF2 and VEGF-A; Lonza) and macrophage media (v/v ...
-
bioRxiv - Microbiology 2019Quote: ... Cell pellets were resuspended in nucleofector buffer (Amaxa Mouse Macrophage Nucleofector Kit (Lonza)) and 2ug of siRNA was added to each tube (Dharmacon) ...
-
bioRxiv - Developmental Biology 2020Quote: ... ESCs were electroporated using Nucleofector II (Amaxa) and mouse ESC Nucleofector kit (Lonza). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with the Amaxa Mouse Neuron Nucleofector Kit (Lonza, VPG-1001) using the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Genetics 2023Quote: ... The Amaxa Mouse Embryonic Stem Cell Nucleofector Kit was used (Lonza, VPH-1001), program A-24 ...
-
bioRxiv - Cell Biology 2019Quote: ... and MF 1 Nucleofector kit (Lonza) according to the manufactures protocols ...
-
bioRxiv - Genomics 2022Quote: ... Nucleofection solutions and cuvette were from Mouse ES Cell Nucleofector kit (Lonza, VPH-1001). Nucleofector (Lonza 2b ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were resuspended in P3 Primary Cell Nucleofector™ Solution containing Supplement 1 (Lonza, Switzerland) and 1 µg of chemically modified sgRNA (Synthego ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified coding gene fragments of heavy-chain variable domains were separated on a 1.5% low-temperature melting agarose gel (Lonza Group AG, Basel, Switzerland). Approximately 700 base pair bands corresponding to the heavy-chain only immunoglobulin were extracted (QIAquick Gel Extraction Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.6 Supplement 1 (Lonza kit, #V4XP-3032), and 1ug of plasmid DNA or 200pmol of chemically stabilized synthetic RNA (Synthego Corp.) ...
-
bioRxiv - Cell Biology 2021Quote: ... containing bone marrow mononuclear cells was washed in 5 ml basal medium (α – MEM containing 10% FBS and 100 U mL−1 penicillin and 100 μg mL−1 streptomycin; Lonza). All washing stages were at 400 x g for 5 minutes.
-
bioRxiv - Cell Biology 2020Quote: ... containing bone marrow mononuclear cells was washed in basal medium (α-MEM containing 10% FBS and 100 U mL-1 penicillin and 100 µg mL-1 streptomycin; Lonza). Cells were subsequently either sorted using MACS or incubated with SNAs.
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfections of primary cells were all performed with the Amaxa Mouse Neuron Nucleofector Kit (Lonza), using the O-005 nucleofection program ...