Labshake search
Citations for Lonza :
201 - 250 of 2510 citations for Mouse EGF Latrophilin Seven Transmembrane Domain Containing Protein 1 ELTD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and 5×106 cells were resuspended in 100μL P3 solution containing Supplement1 (Lonza) with 5μg plasmid DNA (containing gRNA and Cas9-2A-GFP) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and cells were overlaid with DMEM containing 0.45% w/v SeaPlaque agarose (Lonza) in addition to 2% v/v FBS and 1% v/v Pen/Strep ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were grown in complete medium containing Minimum Essential Medium (MEM) (Lonza®) supplemented with 10% FBS (Life Technologies®) ...
-
bioRxiv - Microbiology 2020Quote: ... and cells were overlaid with DMEM containing 0.45% w/v SeaPlaque agarose (Lonza) in addition to 2% v/v FBS and 1% v/v Pen/Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured in 4.5 g/L glucose containing DMEM (BE12-614F, LONZA), supplemented with 10% fetal bovine serum (10500-064 ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... were grown in proliferative conditions in PMA containing medium MBM4 (Lonza CC-3249). For differentiation ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were grown in DMEM containing high glucose and sodium pyruvate (Lonza) supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... YS-EBs were plated onto 10cm dishes containing X-VIVO 15 medium (Lonza) supplemented with interleukin-3 (IL-3 ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Immunology 2022Quote: ... 1 x 10^6 purified naive T-cells were resuspended in 15µL buffer P3 + 5µL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7µL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Microbiology 2020Quote: ... 1 million Jurkat T-cells were resuspended in 100 μL Nucleofector solution (Cell Line Nucleofector™ Kits, Lonza) and combined with 2 μg of the linearized dual-fluorophore vector and 2 μg of the corresponding gRNA/Cas9 plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Cell Biology 2019Quote: ... Primary human melanocytes were grown in proliferative conditions in PMA containing medium MBM4 (Lonza). For differentiation cells were switched to M254 medium for 3-4 population doublings (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... expanded cells were incubated in sodium azide (5mM) containing X-VIVO™ 15 (Lonza) supplemented with 5% human AB serum (PAN-Biotech ...
-
bioRxiv - Immunology 2022Quote: ... in 5mL polypropylene roundbottom tubes containing 1mL X-VIVO-15 media (Lonza BE04-418F). Post-sort cell purity after gating on live cells by FCS/SSC was routinely between 90 and 99% ...
-
bioRxiv - Cancer Biology 2023Quote: ... Osteosarcoma cells (MG63, MNNG/HOS) were cultured in α-MEM containing ultra-glutamine (Lonza) and PC3 cells were cultured in RPMI 1640 (Thermofisher ...
-
bioRxiv - Microbiology 2023Quote: ... containing 0.3 μl/ml SYBR Green I (10,000× in DMSO; Lonza, Cat. No. 50513). Plates were incubated in the dark for at least 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... the dermal fraction containing sweat glands was placed in Hanks Balanced Salt Solution (Lonza) with 1000U/ml collagenase ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were separated by SDS-PAGE using 14% Prosieve (Lonza) polyacrylamide gels and electroblotted to Immobilon-P membranes (Millipore) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with Cas9 ribonucleic protein (RNP) complexes in SF buffer (Lonza), using the pulse codes CM-150 or CV-104 ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 × 105 cells were co-transfected with 3 µg plasmid-sgRNA construct and ssODN (0.6 µM final concentration) with Amaxa Human Stem Cell Nucleofector Kit 1 (Lonza) and program A-023 for the Amaxa Nucleofector Device II ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... Cells were transfected with 250 nM of siRNA and 1 μl of control pMax GFP (Nucleofector X kit, Lonza), using the CU-133 program ...
-
bioRxiv - Cell Biology 2022Quote: ... OCI-LY-1 cells were transfected using the Amaxa® Cell Line Nucleofector® Kit L (Lonza, Basel, Switzerland), program C-05 as previously described(46) ...
-
bioRxiv - Neuroscience 2023Quote: Electroporation with freshly assembled RNP complex was performed on hiPSCs using the Human Stem Cell Nucleofector Kit 1 (Lonza) in conjunction with the Amaxa Nucleofector 2b system (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... with two phosphothiorate linkages on each end were mixed with 82 µL Nucleofector Solution V and 18 µL of Supplement Solution 1 according to manufacturer’s recommendations for the Cell Line Nucleofector Kit V (Lonza). 5×105 U2OS.EGFP parent cells were resuspended in the above mixture and nucleofected with a Lonza Nucleofector 2b Device (Kit V ...
-
bioRxiv - Cancer Biology 2020Quote: ... consisting of 100 pmol of chemically modified sgRNA (Synthego) and 35 pmol of Cas9 protein (St. Jude Protein Production Core) via nucleofection (Lonza, 4D-Nucleofector™ X-unit) using solution P3 and program CA-137 in small cuvettes according to the manufacturers recommended protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... ARPE-19 cells were maintained in Complete media containing DMEM: F12 supplemented (Lonza; Basel, Switzerland) + 10% FBS + 1% PEST + 2.5 mM L-Glutamine ...
-
bioRxiv - Immunology 2019Quote: ... in 5mL polypropylene round-bottom tubes containing 1mL X-VIVO-15 media (Lonza BE04-418F). Post-sort cell purity after gating on live cells by FCS/SSC was routinely between 92 and 99%.
-
bioRxiv - Physiology 2021Quote: ... primary medium was replaced by a growth medium containing REBMTM (Basal Medium, CC-3191, Lonza) supplemented with 2% fetal bovine serum ...
-
bioRxiv - Microbiology 2020Quote: ... the RNP complexes were added to 1×105 cells in 40 μl of P3 nucleofection buffer from the 4D-Nucleofector X kit (Lonza). Half of the mixture was loaded to each well of a 16-well nucleofection cassette and nucleofected using the using E0-100 program with the 4D-Nucleofector Lonza Amaxa ...
-
bioRxiv - Genomics 2020Quote: ... Transfection of these iPSCs with the plasmid and Super piggyBacTM transposase mRNA (Transposagen) was done using the Human Stem Cell Nucleofector Kit 1 (VAPH-5012) by Nucleofector 2b Device (AAB-1001, Lonza) according to the manual ...
-
bioRxiv - Immunology 2021Quote: Control or transfected Lymphocytes (with Flag-wt-TDP-43 or Flag-NLS-mut-TDP-43 plasmid (1 μg) using nucleofection kit (Lonza)) were placed on coverslips (2 x 106 cells in sterile glass coverslips-Ø 12 mm ...
-
bioRxiv - Genomics 2020Quote: 5 × 105 THP-1 cells were resuspended in 20µL nucleofection solution (16.4µL SG nucleofector solution + 3.6µL supplement 1) from the SG Cell Line 4D-Nucleofector™ X kit (Lonza, V4XC-3032). 300pmol PPP2R1A sgRNA (Synthego ...
-
bioRxiv - Cell Biology 2021Quote: ... Patients-derived iPS cells were electroporated with plasmids and single stranded DNA donor oligos using Human Stem Cell NucleofectorTM Kit 1 (Lonza). After 36 hours ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Microbiology 2022Quote: ... Ribonucleoproteins were introduced into 1 × 106 sub-confluent BlaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cell Biology 2022Quote: ... and a gene-edited iPSC homozygous MYBPC3 knock-out (MYBPC3 (-/-)) (Supplemental Table 1).(15–17) iPSCs were verified to be free of mycoplasma contamination using MycoAlert Detection Kit (Lonza). Newly generated lines were karyotyped (WiCell Institute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...