Labshake search
Citations for Lonza :
1 - 50 of 935 citations for Mouse Anti HIV 1 p24 Recombinant Antibody clone 183 H12 5C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and recombinant human insulin 0.5%) (Lonza). Human cervical cancer cell line SiHa from ATCC (ATCC® HTB-35™ ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg ml−1 streptomycin and 15 ng ml−1 recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Cancer Biology 2020Quote: ... recombinant Cas9 nuclease (IDT) and the 4D-Nucleofector (Lonza) as previously described (Wagenblast et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant insulin (20 μg/mL, Lonza, #BE03-033E20), human recombinant EGF (2 ng/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The recombinant plasmid was transfected into HT29 cells using 4D-Nucleofecor (Lonza).
-
bioRxiv - Biophysics 2020Quote: ... hydrocortisone and recombinant human epidermal growth factor (MEGM Bullet Kit CC-4136; Lonza). Cells were maintained in an incubator under standard conditions (36.5 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and performed nucleofection where 1 × 106 of the selected clone were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...
-
bioRxiv - Bioengineering 2023Quote: The PyroGene Recombinant Factor C Endpoint Fluorescent Assay (Lonza, Walkersville, MD, cat # 50-658U) was performed as recommended ...
-
bioRxiv - Biochemistry 2022Quote: ... CD-1 mouse embryonic fibroblasts (MEFs) were obtained from Lonza (Cat#M-FB-481) and inactivated with 10 μg ml−1 mitomycin C (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... An Amaxa Nucleofector 2b Device and a Mouse Embryonic Fibroblast Nucleofector Kit 1 (Lonza) were used to transfect MEFs with βCTF-3xFLAG plasmid using program N-024 of the Nucleofector (Supplementary Figure 3).
-
bioRxiv - Immunology 2020Quote: ... All isolated Tregs were activated by plate bound anti-CD3 and anti-CD28 antibodies and cultured with X-VIVO 20 media (LONZA #04-448Q) supplemented by 1X Pen/Strep ...
-
bioRxiv - Immunology 2022Quote: ... Absence of endotoxins (< 1EU/mL) was confirmed using the PyroGene™ Recombinant Factor C Assay (Lonza) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 100 μg/ml streptomycin and 15 ng/ml recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA and recombinant CAS9 were delivered as ribonucleoprotein (RNP) complexes using a 4D-Nucleofector X-Unit (Lonza). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... cells were transfected with pcDNA3.1 encoding full-length mouse PD-1 or its mutant using nucleofection (Lonza). Transfected cells were sorted for uniform PD-1 staining and culture in medium with 0.4 cells and reporter Jurkat cells stably expressing WT or MT chimeric PD-1 (mhPD-1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The clones were regularly tested using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final clones tested negative for mycoplasma by the MycoAlertTMPlus Mycoplasma Detection Kit (Lonza) and were authenticated using the PowerPlex® Fusion System (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Genetics 2024Quote: 61 pmol Recombinant Alt-RspCas9 protein (IDT) in 10 µL of Human Keratinocyte Nucleofector™ Kit solution (Lonza, VPD-1002) for 10 min and immediately used for nucleofection of 8×105 primary keratinocytes with the Amaxa nucleofection apparatus (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... and the manufacturer’s instructions were followed (PyroGene Recombinant Factor C Endpoint Fluorescent Assay-#50-658U, Lonza Bioscience, Walkersville, MD, USA). Serum samples were diluted at 1:50 for LBP analysis ...
-
bioRxiv - Immunology 2020Quote: ... Rinsed cells were resuspended in buffer P4 (mouse) or P2 (human) at 1-10 x 106 cells/20 μL (Lonza). Non-targeting Alt-R crRNA #1 ...
-
bioRxiv - Immunology 2021Quote: ... Naïve T cells expressing Cas9 were washed once with 1 mL pre-warmed recovery medium (Mouse T Cell Nucleofector Medium, Lonza) before electroporation ...
-
bioRxiv - Bioengineering 2024Quote: ... and activated using anti-human CD3/CD28 dynabeads (Cell Therapy Systems, Thermo) at a 1:1 ratio in XVivo 15 media (Lonza) supplemented with 5% FBS (MilliporeSigma ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: Jurkat T cells (clone E6.1) were grown in RPMI 1640 medium w/ L-Glutamine (Lonza) supplemented with 9% Fetal Bovine Serum and 1% penicillin/streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Single clones were then grown in culture flasks in RPMI-1640 (Lonza, BioWhittaker, Basel, Switzerland) supplemented with sodium pyruvate (Gibco™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Final clones tested negative for mycoplasma by the MycoAlert™ Plus Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2021Quote: ... 1.5×106 cells multiplied by the number of mice to be injected were transfected with the pIL-10 vector (1×106 cells/1.5 μg pIL-10 DNA per cuvette) using the Mouse T Cell Nucleofector Kit (Lonza, No: VPA-1006) with Nucleofector II Device (program X-100) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... we assembled Cas9/gRNA RNP complexes in vitro by mixing 16 μg of recombinant Cas9 (IDT) and 120 pmol of in vitro transcribed gRNA (IDT) in 100 μl of SE buffer (Lonza, cat# PBC1-00675) and incubating at room temperature for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: The WFS1 and WFS1wt/757A>T iBeta from two clones/line were disaggregated by trypsin (Lonza) and captured using the droplet-based Chromium 10X platform ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the mouse ES cell nucleofection kit (Lonza) using protocol “A24” ...
-
bioRxiv - Bioengineering 2023Quote: Mouse C57 Cortex Neurons (Lonza, M-CX-300) were cultured in Primary Neuron Basal Medium (PNBM ...
-
bioRxiv - Immunology 2023Quote: ... X-Unit (Lonza, program: unstimulated mouse T cells). Cells were washed immediately after nucleofection to remove nucleofection reagents and improve survival.
-
bioRxiv - Neuroscience 2024Quote: ... and mouse neuron nucleofectorTM kit (VPG-1001, Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections for specific recombination in TCIS clones were performed with the electroporation system (Amaxa Nucleofector 4; Lonza), to ensure essentially 100% transfection efficiency ...
-
bioRxiv - Cell Biology 2023Quote: ... clones were selected by limiting dilution in 96 well plates using MEGM Complete Medium (CC-3150, Lonza) with 100 ng/mL cholera toxin (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... BHK-21 Clone 13 (ATCC number CCL-10) were cultured in Glasgow Minimum essential medium (GMEM, Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: Jurkat T cells (clone E6.1; ATCC TIB-152) were grown in RPMI 1640 medium w/ L-Glutamine (Lonza) supplemented with 10% Fetal Bovine Serum and 1% penicillin/streptomycin ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... All generated knockout clones were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-318).
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...