Labshake search
Citations for Lonza :
1 - 50 of 104 citations for M CHERRY MRNA mCherry Fluorescent Protein coding mRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The concentration of IL-2 was increased to 1000 IU/ml on day 7 and the expanded T cells were electroporated with the indicated mRNA at a concentration of 2 pg mRNA/cell on day 8 using 4D Nucleofector™ System (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: T cells were transfected with control mRNA or ME1 mRNA (220 μg/ml) using the P3 nucleofection kit (Lonza V4XP-3024) and program FI-115 on the 4D Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 µg mRNA was transfected into 0.5× 106 fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... REP-TILs were transfected with anti-HER2 CAR mRNA via electroporation using a 4D nucleofector (Lonza). This mRNA was generated by PCR amplification of the coding sequence of anti-HER2-CAR (40 ...
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Synthetic Biology 2022Quote: 1 x 106 BHK-21 cells were electroporated with a total of 7.8 μg of mRNA (1:1:1 of pSinHelper, pSinCapsid and pTSin-EGFP/pTSin-SRF-NLS-VP64) using Amaxa 2B (Lonza) as per the manufacturer’s instructions for BHK-21 cells ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 10 µL of transduced cells were mixed with 90 µL of SF buffer and ZFN mRNA and electroporated using a 4D-X nucleofector using pulse code FF-120 per manufacturer’s recommendation (Lonza, Basel, Switzerland). Cells received 1.6 µg of CCR5-specific ZFN mRNA or 0.7 µg of each AAVS1-specific ZFN mRNA.
-
bioRxiv - Bioengineering 2022Quote: Human umbilical vein endothelial cells expressing green fluorescent protein (GFP-HUVECs) (C2519A, Lonza, Basel, Switzerland) were cultured in a supplemented (EGM-2 bullet kit ...
-
bioRxiv - Bioengineering 2024Quote: Human umbilical vein endothelial cells expressing green fluorescent protein (GFP-HUVECs) (C2519A, Lonza, Basel, Switzerland) were cultured in a supplemented (EGM-2 bullet kit ...
-
bioRxiv - Immunology 2020Quote: 3T3 cells were transfected with either hACE2 or GFP mRNA using an Amaxa cell line nucleofector L kit (Lonza; catalog number VCA-1005) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Immunology 2023Quote: ... 2 million of CAR-T cells were electroporated with 1 μg Cas9 mRNA in 16-well Nucleocuvette™ Strips using EO-115 program (Lonza, per manufacturer’s instructions). Cells were expanded in human T cell media for another 3 days before analysis or transfer into mice.
-
bioRxiv - Immunology 2023Quote: ... 2 million of CAR-T cells were electroporated with 1 μg Cas9 mRNA in 16-well Nucleocuvette™ Strips using EO-115 program (Lonza, per manufacturer’s instructions). Cells were expanded for another 2 days before transfer into NSG mice.
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with pcDNA3 HA eIF4GI plasmid or control green fluorescent protein (GFP)-expressing plasmid (pMAX-GFP plasmid, Lonza). pcDNA3 HA eIF4GI (1–1599 ...
-
bioRxiv - Bioengineering 2021Quote: Primary human umbilical vein endothelial cells (HUVECs) and red fluorescent protein-expressing HUVECs (RFP-HUVECs) were maintained in EMG-2 medium (complete EGM-2 BulletKitTM, Lonza). We obtained human umbilical cords from Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... TG trigeminal ganglion neurons were transfected with 3 µg of NaV1.7-PEPCy3 plasmid and 0.75 µg green fluorescent protein (GFP) using the rat neuron 4D-Nucleofector solution (P3 Primary Cell Solution, program DR 114; Lonza Biosciences). Neurons were plated on round bottom glass dishes (cat ...
-
bioRxiv - Bioengineering 2022Quote: All coding sequences used in this study were cloned into pmax expression vector (Lonza) by TEDA as previously reported (46) ...
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Genomics 2020Quote: ... G8PPD-coding plasmid (1 μg) was mixed with re-suspended K562 cells and nucleofected by Lonza 4D nucleofector with program FF-120 ...
-
bioRxiv - Immunology 2020Quote: ... for exECs (Program M-003, Nucleofector 2b, Lonza).
-
bioRxiv - Immunology 2021Quote: ... for exECs (Program M-003, Nucleofector 2b, Lonza), and using the GPR39 siRNA Silencer Select purchased from Thermo ...
-
bioRxiv - Bioengineering 2023Quote: Mouse C57 Cortex Neurons (Lonza, M-CX-300) were cultured in Primary Neuron Basal Medium (PNBM ...
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescent nuclear counterstaining was performed using DAPI (Lonza, cat#: PA3013).
-
bioRxiv - Developmental Biology 2024Quote: ... H9 cells were transfected with the PB-GFP-P2A-ΔNβCAT plasmid and a Piggybac transposase-coding plasmid using the P3 primary cell 4D nucleofector kit (Lonza). After 48 hours ...
-
bioRxiv - Immunology 2023Quote: ... Accugene 0.5 M EDTA solution was obtained from Lonza Bioscience.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified coding gene fragments of heavy-chain variable domains were separated on a 1.5% low-temperature melting agarose gel (Lonza Group AG, Basel, Switzerland). Approximately 700 base pair bands corresponding to the heavy-chain only immunoglobulin were extracted (QIAquick Gel Extraction Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Bioengineering 2023Quote: The PyroGene Recombinant Factor C Endpoint Fluorescent Assay (Lonza, Walkersville, MD, cat # 50-658U) was performed as recommended ...
-
bioRxiv - Cancer Biology 2022Quote: Primary mouse embryonic fibroblasts (MEFs) were purchased from Lonza (M-FB-481). They were expanded in Advanced DMEM supplemented with 15% fetal bovine serum ...
-
bioRxiv - Bioengineering 2019Quote: ... mCherry-transfected) were cultured at 37°C in 5% CO2 in EGM®-2 Endothelial Cell Growth Medium-2 (Lonza). Patient-derived glioblastoma multiform (GBM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10,000,000 lymphoblastoid cells were nucleofected with 60 µg of RTW3027 and 20 µg of plasmid expressing gRNA and mCherry using Cell Line NucleofectorTM Kit V (Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... first excised floxed Neomycin resistance cassette from Oct4 (CiA:Oct4) mESCs 12 by transfecting Cre-mCherry plasmid using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 24 hours after transfection ...
-
bioRxiv - Biophysics 2020Quote: ... The cell pellet was suspended in 100 μL electroporation medium and electroporated for either GFP-Nrx1β or NLG1-mCherry plasmids with the Amaxa Nucleofector system (Lonza), using 500,000 cells per cuvette and 3 μg DNA ...
-
bioRxiv - Microbiology 2023Quote: ... purified schizonts derived from the hap2ko mCherry parasite was electroporated using the FI-115 program of the 4D nucleofector system (Lonza). Transfected schizonts were then injected intravenously into BALB/c mice ...
-
bioRxiv - Biophysics 2021Quote: ... 1% Penicillin/Streptomycin and 20% supernatant of M-CSF expressing L-929 cells (Lonza) in untreated six-well culture plates ...
-
bioRxiv - Biophysics 2021Quote: ... 1 % L-Glutamine and 20 % supernatant of M-CSF expressing L-929 cells (Lonza).
-
bioRxiv - Biochemistry 2022Quote: ... CD-1 mouse embryonic fibroblasts (MEFs) were obtained from Lonza (Cat#M-FB-481) and inactivated with 10 μg ml−1 mitomycin C (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2021Quote: For fluorescent imaging, HEK293A cells (ATCC, USA) were maintained in Dulbecco’s Modified Eagle Medium (DMEM - Lonza, Switzerland) complemented with 10% fetal bovine serum (Biosera ...
-
bioRxiv - Genomics 2021Quote: ... Growing CH12F3 cells were transfected with 1.5 μg pX330-Cas9 or pX330-Cas9-mCherry expression vector per million by 4D-nucleofector X (Lonza, solution M1, procedure DN100) and seeding at 0.5 million cells/mL in fresh medium with 1μg/mL anti-CD40 ...
-
bioRxiv - Microbiology 2021Quote: HEK293 cells (obtained from M. Marketon’s laboratory) were maintained in Dulbecco’s modified essential medium (DMEM) (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... We then electroporated 4.0×105 of wildtype or the stably integrated mCherry K562 cell lines in 100 μL Amaxa solution (Lonza Nucleofector 2b, program T-016) with pJT396 in combination with an equimolar amount of either pUC19 or a Cp36 expression vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Microbiology 2019Quote: ... and 25 ng/ml of amphotericin B. HEK293 cells (obtained from M. Marketon’s laboratory) were maintained in Dulbecco’s modified essential medium (DMEM) (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Both HeLa M and 293T cells and their derivatives were maintained in Dulbecco’s modified Eagle medium (DMEM) (Lonza) supplemented with 10% of fetal calf serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... mixed with 2 µM control or 2 µM target-specific ASO and transferred to nucleocuvettes for nucleofection on a 4D-Nucleofector System (Lonza) using program code “DC-100” ...