Labshake search
Citations for Lonza :
1 - 50 of 54 citations for Ketoconazole EP Impurity D since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Immunology 2021Quote: ... 1 million cells were suspended in 30ul of EP buffer (Lonza) with 3μg of either pcDNA3-FLAG-HA (EV ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... All recovered cell fractions were rested overnight in EP-TICLE culture media consisting of X Vivo-15 (Lonza) supplemented with 2% KnockOut serum replacement (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: A total of 500,000 CD34+ hiPSC-EPs were centrifuged twice and resuspended in Complete Endothelial Growth Media 2 (EGM-2, Lonza) supplemented with 50 ng/mL recombinant human vascular endothelial growth factor (VEGF ...
-
bioRxiv - Immunology 2023Quote: ... and cultured in 96-well culture plates (2×103 cells/well) with serum or EP-stimulated MDMs supernatants in X-VIVO 15 medium (Lonza) with 10 U/mL of IL-2 (PeproTech ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 µL aliquots (7 × 106 cells) were then transferred into 2 mm EP cuvettes and electroporated on an Amaxa Nucleofector I (Lonza). For A2780 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4-D nucleofector (LONZA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Pre-warmed D-PBS (Lonza) was added to the apical side of the insert 5min prior to TEER measurement ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... D Drucker) were routinely cultured in Dulbecco’s modified eagle medium (DMEM) (5.5 mmol/L D-glucose) (Lonza, UK), supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... human dermal microvascular endothelial cells (HMVECs-D) (Lonza) or human brain microvascular Endothelial Cells (HBMECs ...
-
bioRxiv - Immunology 2020Quote: ... resuspended in endotoxin-free PBS (D-PBS Lonza), counted under dark field microscopy using a Petroff-Hauser chamber and diluted to the appropriate concentration ...
-
bioRxiv - Cell Biology 2020Quote: Electroporation was performed using an Amaxa 4-D device (Lonza) or a Neon Transfection System (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: SV40LT-immortalized MEFs were grown in D-MEM (Lonza, BE12-614F) supplemented with 10% fetal bovine serum (EuroClone ...
-
bioRxiv - Molecular Biology 2020Quote: ... HeLa 1.3 cells were grown in D-MEM (Lonza, BE12-614F) supplemented with 10% fetal bovine serum (EuroClone ...
-
bioRxiv - Bioengineering 2023Quote: ... Adult human dermal microvascular endothelial cells (HMVEC-d) (LONZA, Cat# CC-2543) (passage 8 ...
-
bioRxiv - Immunology 2023Quote: ... PmaxTM GFP expression vector was acquired from Lonza (cat numb #D-00061). Expression plasmid for ZIKV NS5 was generated by amplifying the NS5 coding sequence (amino acids 2521-3423 in the polyprotein ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were nucleofected with the 4-D Nucleofector System (Lonza, Cat#AAF-1003X) using the CA-137 program ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell/DNA mixture was then nucleofected using the 4-D nucleofector system (Lonza) code CB-150 and densely replated on Matrigel coated 6-well plates at 2.5×106 cells per well ...
-
bioRxiv - Bioengineering 2021Quote: T47-D human breast cancer cell line was cultured in RPMI-1640 (Lonza, Switzerland) supplemented by 10% FBS (EuroClone ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was aspirated and cells were resuspended in 15 μL buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated in the RNP mix ...
-
bioRxiv - Microbiology 2024Quote: Primary human dermal microvascular endothelial cells (hMVEC-d) were purchased from Lonza (CC-2543), grown in EBM (CC-3156 ...
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program EO-115 on a 4-D Nucleofector X unit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... and plated on poly-D-lysine coated flasks with astrocyte growth media (Lonza, Basel, Switzerland), changing the media every 3 days ...
-
bioRxiv - Immunology 2023Quote: ... and primary T cells were electroporated using the P3 Primary Cell 4-D Kit (Lonza). For Cas9 and sgRNA delivery ...
-
bioRxiv - Bioengineering 2024Quote: ... and fibroblasts were nucleofected using a 4-D Nucleofector system and 96-well unit (Lonza). gRNAs were prepared by annealing crRNA and trcrRNA (IDT ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Bioengineering 2024Quote: ... and seeded with human pulmonary artery endothelial cells in rectangular channel experiments (HPAEC, Lonza, Fig.1A-D), or human umbilical vein endothelial cells in round channel experiments (HUVEC ...
-
bioRxiv - Cell Biology 2024Quote: ... and it contains Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP, Lonza, Cat. No. D-00059) using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were passaged in poly-D-Lysine treated plates and incubated overnight in OPTI-MEM medium (Lonza) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... STD-M (−) consisted of Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2020Quote: ... HMVECs-D were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 MV BulletKits™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...