Labshake search
Citations for Lonza :
301 - 350 of 436 citations for IL 5 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were grown at 37℃ and 5% CO2 and were tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Testing Kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Any CD146 positive cells were eluted from the column using 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza). The cells were pelleted with a 300 g spin for 5 min and counted in 1 mL EGM-2 media ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ... or ds-UM DNA oligos (IDT) (Table S4) were nucleofected into mouse ES cells using an Amaxa nucleofector (Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and wild-type J1 male mouse embryonic stem cells were grown on 0.1% gelatin-coated dishes in DMEM (Lonza) complemented with 10% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... On day 7 cells were nucleofected using the Amaxa Mouse T Cell Nucleofector Kit (Lonza, Cat no. VVPA-1006) per the manufacturer’s instructions with 5x106 cells and 1.5µg plasmid DNA per cuvette ...
-
bioRxiv - Cell Biology 2021Quote: ... MEFs were immortalized with pBabe-SV40Tag by electroporation using the Amaxa Mouse/Rat Hepatocyte Nucleofector Kit (Lonza, VPL-1004). Immortalized MEF lines were genotyped ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse CCL206 lung fibroblasts (CCL-206; ATCC, Wesel, Germany, RRID: CVCL_0437) were cultured in DMEM (Lonza, Basel, Switzerland, #42430):Ham’s F12 (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were authenticated by Brca1/2-specific PCR-based genotyping (mouse)7,8 and they were regularly tested for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2023Quote: ... Ki-67 depletion was performed by nucleofection with an siRNA against mouse Ki-67 (CGUUGAUAUCAGCAACUUU) using Amaxa Nucleofector (Lonza), in accordance with the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 103 cells were plated in low-attachment 96-well plates containing 100 μL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL bFGF (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... collected by centrifugation at 500xg for 5 min and resuspended in SF solution (SF cell line 4D-Nucleofector™ X Kit, Lonza). After addition of the RNP ...
-
Optimisation of immunocytochemistry methodology for the detection of endogenous eIF2B localised focibioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37ºC under 5% CO2 in a humidified atmosphere and routinely tested for contamination with MycoAlter™ Mycoplasma Detection Kit (Lonza, UK). Cells were validated through lineage-specific markers - anti-GFAP antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were maintained at 37°C under 5% CO2 and were routinely tested for contamination with MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were maintained at 37°C in a 5% CO2 humidified atmosphere and were regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, Switzerland).
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... A total of 500,000 cells were transfected using the using the mouse neural stem cell nucleofection kit (Lonza, VPG-1004) with 0.66 μg of the construct and 0.33 μg of transposase using the Lonza Amaxa Nucleofector I with protocol A-33 ...
-
bioRxiv - Neuroscience 2019Quote: ... Ganglionic eminences and cortex were dissected and dissociated cortical neurons were nucleofected with ON-TARGET plus mouse Mecp2 siRNA or Non-targeting siRNA 1 (Dharmacon) according to the protocol of Amaxa Nucleofection (Lonza). Then neurons were plated into microchambers coated with poly-D-lysine (0.1 mg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: 1-4 × 106 dissociated cells were re-suspended in 100 µL of Amaxa Mouse NSC Nucleofector Solution (VPG-1004, Lonza) with 5 µg of plasmid DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... the cell suspension was transfected with a Homer 1c::TdimerDsRed plasmid (Bats et al., 2007) by electroporation using the Amaxa Nucleofector 2b device and Amaxa mouse neuron nucleofector kit (Lonza). Neurons were then plated on poly-L-lysine-coated glass coverslips and grown at 37°C in a humidified 5% CO2-containing atmosphere in BME supplemented with KCl (25 mM final concentration) ...
-
bioRxiv - Immunology 2020Quote: ... Rinsed cells were resuspended in buffer P4 (mouse) or P2 (human) at 1-10 x 106 cells/20 μL (Lonza). Non-targeting Alt-R crRNA #1 ...
-
bioRxiv - Microbiology 2022Quote: ... Blood schizont purification was performed using a Nycodenz (Axis Shield) gradient following the culture of infected mouse blood in RPMI 1640 (Lonza) supplemented with 50 µg/ml neomycin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Knockdown of Vps4a/b was performed using Amaxa Nucleofector II and the Mouse T-Cell Nucleofector Kit (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...