Labshake search
Citations for Lonza :
1 - 50 of 3489 citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Cancer Biology 2023Quote: ... (v) human neonatal dermal fibroblast cell lines NDF-2 and NDF-3 (#CC-2509; Lonza Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleofection Kit V Complete Solution and Nucleofector 2 were from Lonza. Phusion Plus PCR Master Mix was from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Immunology 2023Quote: ... containing 10% v/v deactivated fetal bovine serum (dFBS, Lonza, Basel, Switzerland), 100 µg/mL streptomycin (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... with 0.05 mL blocking buffer (98% v/v FACS buffer (PBS + 2% v/v dFBS (Lonza)) and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Cell Biology 2024Quote: ... along with the Human Stem Cell Nucleofector™ Kit 2 (Lonza). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... transfection was performed with 3.5 μg of PF16eYFPNeo introduced into 108 cells using a Human T-cell kit and IIb Nucleofector set to program X-001 (Lonza). Other transfections described in this work used the same conditions except with Tb-BSF buffer (90 mM sodium phosphate ...
-
bioRxiv - Immunology 2022Quote: ... 2×106 B cells were then nucleofected with 2 μg of plasmid DNA using Nucleofector Kit V (Lonza) and rested for at least 16-24 hours using complete media containing 5 ng/ml BAFF and lacking LPS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nucleofection (Nucleofector kit V, Lonza, program V-001) following the manufacturer’s instructions was used for overexpression experiments in THP-1 cells ...
-
bioRxiv - Immunology 2022Quote: Human ventricular cardiac fibroblasts (NHCF-V, Lonza, CC-2904), adult human dermal fibroblasts (NHDF-Ad ...
-
bioRxiv - Molecular Biology 2019Quote: ... buffer kit V (Lonza) and program A-023 ...
-
bioRxiv - Genomics 2023Quote: ... were purchased from ATCC and cultured in endothelial cell growth basal medium-2 containing bullet kit growth factor supplements (EBM-2 [endothelial cell growth basal medium-2]; Lonza), 5% fetal bovine serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2×106 iPSC single cells were transfected using the Amaxa Human Stem Cell Nucleofector® Kit 2 (Lonza) with 4 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2 mM Ultraglutamine (Lonza), 1% Nonessential aminoacids (NEAA) ...
-
bioRxiv - Genetics 2021Quote: ... The cells were electroporated by using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... We used the Human Stem Cell Nucleofector Kit 2 (Lonza, catalog no. LONVPH-5022). After electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were transfected into human U2OS cells (ATCC HTB-96) by Amaxa electroporation with Nucleofector™ Kit V (Lonza) and plated in 6 well plates containing glass slides.
-
bioRxiv - Microbiology 2021Quote: ... 2x overlay media was added to the inoculum to give a final concentration of 2% (v/v) FBS / MEM media and 0.4% (w/v) SeaPrep Agarose (Lonza) to achieve a semi-solid overlay ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were nucleofected using the Human Stem Cell Nucleofector® Kit 2 (Lonza, VPH-5022) in combination with the AMAXA-2b nucleofector ...
-
bioRxiv - Physiology 2019Quote: ... 10% AIM-V and 100 units/ml penicillin/ streptomycin and transiently transfected using Nucleofector™ Kits for Human Melanocytes (Lonza) or magnetofection with PolyMag Neo magnetic beads (OZ Biosciences) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% (w/v) L-glutamine and 0.1% (w/v) Gentamicin-Amphotericin (#PT-3001; Lonza, Germany) with 5% CO2 in air at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Human neuroblastoma SH-SY5Y cells were grown in a 1:1 (v/v) mixture of EMEM with EBSS (Lonza) and Ham’s F12 (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... Nucleofector Kit V was from Lonza. The original vector pCasper-GR (#FP971 ...
-
bioRxiv - Biochemistry 2022Quote: ... Nucleofector Kit V (Lonza, VCA-1003); paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Bioengineering 2024Quote: Primary human ventricular cardiac fibroblasts (NHCF-V; Lonza, cat. no. CC-2904) were cultured according to the manufacturer’s protocol with Fibroblast Growth Medium 3 (PromoCell ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary human skeletal muscle myoblasts (HSMMs) were cultured in growth medium (SkGM-2 Bullet Kit, Lonza). HEK293T cells (kindly gifted by Slimane Ait-Si-Ali lab ...
-
bioRxiv - Cell Biology 2021Quote: ... Media was then changed to EBM™-2 Endothelial Cell Growth Basal Medium-2 containing bullet kit growth factor supplements (Lonza), 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were purchased from ATCC and cultured in EBM™-2 Endothelial Cell Growth Basal Medium-2 containing bullet kit growth factor supplements (Lonza), 5% fetal bovine serum ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Endothelial Basal Medium-2 + SingleQuots (Lonza), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Dissociated hiIPSC derived myocytes were mixed with human cardiac fibroblasts (Lonza, NHCF-V) at the ratio of 9:1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the AMAXA-V kit (VCA-1003, Lonza) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and Amaxa Kit V (Lonza #VCA-1003) Program T-023.
-
bioRxiv - Cell Biology 2023Quote: ... or the Amaxa nuclefector kit V (Lonza) and Amaxa Nucleofector II (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... 2% glutamine and 5% human serum AB (Lonza) for seven days ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4×106 cells were electroporated with 10 μg DNA of pBluescript II SK(+) carrying a human U6 promoter and EGFP-sgRNA using Nucleofector® V Kit (Lonza, Switzerland) as described above.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human umbilical venous endothelial cells (HUVECs) and EGM-2 bullet kits were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and mN designates the 2’-O-methylribonucleotides) was transfected into HAP1 cells (1.0 × 106 cells) by Nucleofector Kit V (Lonza) with a Nucleofector device (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... and cells were overlaid with DMEM containing 0.45% w/v SeaPlaque agarose (Lonza) in addition to 2% v/v FBS and 1% v/v Pen/Strep ...
-
bioRxiv - Microbiology 2020Quote: ... and cells were overlaid with DMEM containing 0.45% w/v SeaPlaque agarose (Lonza) in addition to 2% v/v FBS and 1% v/v Pen/Strep ...
-
bioRxiv - Immunology 2020Quote: ... overlaid with cDMEM containing 2% SeaPlaque Agarose (Lonza), and incubated at 37°C for an additional 24 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... 20,000 cells were resuspended in 100 μL nucleofection buffer from Human Stem Cell Nucleofector™ Kit 2 (Lonza). Salsa6f-AAVS1 SHL plasmid Template (2 μg ...
-
bioRxiv - Cell Biology 2020Quote: U-2 OS cells stably expressing spdCas9-GFP were nuclofected with Amaxa® Cell Line Nucleofector® Kit V (Lonza). Cells were detached with 0.05% trypsin/EDTA and spun down by centrifugation at 1000rpm for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and Lonza nucleofection kit V (Lonza, VCA-1003) following manufacturer’s guidelines ...