Labshake search
Citations for Lonza :
1 - 50 of 1015 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... siRNA against human genes or control siRNA were incubated with a mixture of nucleofection solution (Human Monocytes Nucleofector kit; Lonza) and primary human monocytes and placed in nucleofection cuvettes subjected to program Y-010 for the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2024Quote: IL4I1 knockdown was carried out using siRNA methodology and Human T Cell Nucleofector Kit (Lonza, Basel, Switzerland) using manufacturer instructions ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... the siRNAs were transfected into human CD4+ T cells using the Amaxa Nucleofector following the manufacturer’s protocols (Lonza). The siRNAs used in this study were purchased from GenePharma and the sequences are as below:
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated by CD3/CD28 Abs for 2 days and nuclofected with 100 μM RORC or non-targeting (NT1) siRNA (ON-TARGETplus SMART pool, Dharmacon) using the Amaxa Human T cell Nucleofector Kit (Amaxa, Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 4 μM of each siRNA (TriFECTa® RNAi Kit, IDT) or negative control siRNA (Universal Negative Control siRNA [Nippon Gene]) by nucleofection (Lonza) using reagent V and the X-001 program ...
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... Activated cells were nuclofected with 100 µM AhR or non-targeting (NT1) siRNA (ON-TARGETplus SMART pool, Dharmacon) using the Amaxa Human T cell Nucleofector Kit (Lonza, Walkersville, MD, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... was performed by nucleofection of primary cDCs isolated from HD with specific siRNAs (SMART-pool, Horizon Discovery) or irrelevant scramble siRNA in an Amaxa4D-Nucleofector (Lonza) instrument using the CM120 protocol and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Transient siRNA transfections were performed using Amaxa kits C (Amaxa Lonza) for CEM.NKR-CCR5 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... siRNAs were transiently transfected into NB cells using Nucleofector electroporation (Lonza): solution L and program C-005 for IMR32 and IMR5 ...
-
bioRxiv - Immunology 2021Quote: Transfection of siRNA was carried out using the 4D Nucleofector (Lonza) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids and siRNAs were then transfected with a 4D-Nucleofector (Lonza) using program EI-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs were transiently transfected into NB cells using Nucleofector electroporation (Lonza): solution L and program C-005 for IMR32 ...
-
bioRxiv - Genomics 2022Quote: Human primary proximal tubular cells (human RPTEC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Human primary proximal tubular cells (human RPTEC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... control- or REST-siRNA transfected as described earlier (Dharmacon, Lonza, and Invitrogen). 500 ng of RNA was used for cDNA synthesis for transcriptome sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... HBMEC were transfected with lentivirus or siRNA in EGM-2 media (Lonza). HeLa (ATCC CCL-2 ...
-
bioRxiv - Bioengineering 2022Quote: Human (Lonza, HUM4198) and rhesus macaque (Lonza ...
-
bioRxiv - Genomics 2024Quote: Human primary proximal tubular cells (human primary PTC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Genomics 2024Quote: Human primary proximal tubular cells (human primary PTC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... siRNA was transfected with Amaxa cell line nucleofector kit and Nucleofector II (Lonza) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... CAF siRNA transfections were performed by nucleofection using the Amaxa kit R (Lonza) and downstream experiments were performed 5 days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary human melanocytes (Normal Human Epidermal Melanocytes, NHEM) were obtained from Lonza. All cell culture reagents were obtained from GIBCO Life technologies ...
-
bioRxiv - Bioengineering 2021Quote: Human MSCs were isolated from fresh bone marrow from human donors (Lonza, male 23 years ...
-
bioRxiv - Molecular Biology 2022Quote: Human primary EC(Lonza) were cultured in complete endothelial basal medium (EBM ...
-
bioRxiv - Physiology 2020Quote: ... Normal human astrocytes (Lonza) were cultured in astocytic basal medium (ABM ...
-
bioRxiv - Neuroscience 2022Quote: Primary human astrocytes (Lonza) were maintained in a complete astrocyte growth medium (ScienCell ...
-
bioRxiv - Neuroscience 2022Quote: Primary human astrocytes (Lonza) were maintained in complete astrocyte growth medium (ScienCell ...
-
bioRxiv - Neuroscience 2024Quote: Primary human astrocytes (Lonza) were cultured in a complete astrocyte growth medium (ScienCell ...
-
bioRxiv - Neuroscience 2024Quote: Fetal human astrocytes (Lonza) were cultured in Astrocyte Media (ScienCell ...
-
bioRxiv - Bioengineering 2023Quote: Human BMSC (Lonza, 19TL155677) were thawed and plated at 6000 cells/cm2 in an expansion culture medium containing a basal alpha minimum essential medium (α-MEM,22571) ...
-
bioRxiv - Developmental Biology 2023Quote: Human aortic SMCs (Lonza) were cultured up to passage 6 in M199 medium supplemented with 10% FBS and growth factors (PeproTech ...
-
bioRxiv - Bioengineering 2023Quote: ... Human lung fibroblasts (Lonza) at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology ...
-
bioRxiv - Immunology 2024Quote: ... human keratinocytes (NHEK; Lonza) were used for testing potency of BAL-0028 ...
-
bioRxiv - Bioengineering 2024Quote: ... Human primary hepatocytes (Lonza Catalog # ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection of siRNAs into BMMCs was performed using the Amaxa Nucleofector Kit T (Lonza). BMMCs were pelleted and resuspended at a concentration of 2×106 cells/100 μL Nucleofector T solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with Dharmacon ON-TARGETplus siRNAs using the Amaxa Nucleofector system (Lonza).
-
bioRxiv - Immunology 2023Quote: ... HUVEC were nucleofected (AMAXA) with siRNAs (100pmol) using HUVEC transfection reagent (VPB-1002, Lonza). Cells were used 48h after transfection.
-
bioRxiv - Bioengineering 2020Quote: Human MSCs (hMSCs) were isolated from fresh unprocessed bone marrow from human donors (Lonza) as previously described 63 ...
-
bioRxiv - Immunology 2021Quote: Human normal dendritic cells (Lonza) were cultured in 50 ng/ml GM-CSF and 50 ng/ml IL-4 for 5 days ...
-
bioRxiv - Bioengineering 2021Quote: Cryopreserved primary human hepatocytes (Lonza) were thawed according to manufacturer’s protocol and the cells were directly used in experiments ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Normal human lung fibroblasts (Lonza) and Primary Human IPF Lung Parenchymal Fibroblasts (Donor2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Normal human astrocytes (NHA)(Lonza) were thawed at P5 and cultured for 5-10 days prior to cell seeding ...
-
bioRxiv - Microbiology 2024Quote: ... normal human bronchial epithelial (Lonza), and porcine primary nasal epithelial (24 ...
-
bioRxiv - Microbiology 2023Quote: Human Intestinal Myofibroblasts (HIMF) (Lonza) were trypsinized ...
-
bioRxiv - Bioengineering 2024Quote: ... and recombinant human insulin 0.5%) (Lonza). Human cervical cancer cell line SiHa from ATCC (ATCC® HTB-35™ ...
-
bioRxiv - Biophysics 2024Quote: Human umbilical vein ECs (Lonza) were cultured using standard protocols in Endothelial Growth Medium (EGM2 ...