Labshake search
Citations for Lonza :
301 - 350 of 2520 citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2019Quote: ... These growth factors were supplied as a bullet kit (Cell Media and Bullet Kit, Lonza). HUVECs were passaged 2-6 times.
-
bioRxiv - Physiology 2022Quote: ... in F12 : DMEM (1 : 1) (Lonza, UK). Following digestion the suspension was passed through sterile gauze and a 70 µm cell strainer before centrifugation at 350 g for 10 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: MG-63 cells (1000 per well, 24-well plate) were seeded into 0.4% low melting point agarose (Lonza, 50101) on top of a 1% agarose layer ...
-
bioRxiv - Neuroscience 2020Quote: ... EBs were collected and transferred into 6-well cell culture plate (12-16 EBs/well) in X-VIVO15 (Lonza) supplemented with IL-3 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Vero cells were plated at 2.5 x 105 cell/well in 24-well plates in Essential-modified Eagle Medium (EMEM, Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2021Quote: ... These cells were then seeded at densities as above in ultra-low adherent round-bottom 96-well plates (Lonza) for 60 hours ...
-
bioRxiv - Cell Biology 2021Quote: Tracheal cells (60,000-100,000 cells/ well in 96 well plate) were cultured in small airway growth media (SABMTMBasal Medium, CC-3119 Lonza) containing 1× insulin ...
-
bioRxiv - Neuroscience 2022Quote: Primary human astrocytes were cultured on Matrigel-coated (0.08 mg/well) 6-well plates in astrocyte growth medium (Lonza). On the day of plating ...
-
bioRxiv - Bioengineering 2022Quote: ... monolayers were dissociated and re-plated at a lower density (13k/cm2) on 0.1% gelatin-coated plates in Endothelial Growth Medium-2 (EGM-2, Lonza) supplemented with VEGF ...
-
bioRxiv - Cell Biology 2022Quote: ... HLFs were seeded in four wells of a 24-well plate in antibiotic free medium containing 2 % (Lonza, PromoCell) or 10 % (DZL ...
-
bioRxiv - Systems Biology 2022Quote: DMECs were plated on poly-L-lysine-coated 6-well glass-bottom plates at 8,450 cells per cm2 in either BPM or growth medium (EGM2-MV, Lonza). After 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... We then placed a 100 μL droplet of the ice-cold monomer solution containing 0.1% (wt/vol) ammonium persulfate onto a hydrophobic glass plate treated with GelSlick (Lonza). The coverslip bearing the flattened sample was then inverted onto the droplet to form a uniform layer of monomer solution ...
-
bioRxiv - Immunology 2023Quote: ... one plate was prepared with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Biochemistry 2023Quote: ... HEK293T cells (1.7 x 105 cells/well in 12-well plates) were grown for 24 h in supplemented DMEM (Lonza), before to be incubated with 20 μg/mL 55Fe-transferrin for 24 h and transiently transfected with wild-type or mutated FPN1-V5 plasmid constructs ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293T cells (1.7 × 105 cells/well in 12-well plates) were grown for 24 h in supplemented DMEM (Lonza), before to be incubated with 20 µg/mL 55Fe-transferrin for 24 h and transiently transfected with wild-type or mutated FPN1-V5 plasmid constructs ...
-
bioRxiv - Bioengineering 2024Quote: hMSC were plated at 15,000 cells/well in 24-well plates and grown overnight in a growth medium containing 10% FBS (Lonza). When cells reach 80% confluency ...
-
bioRxiv - Bioengineering 2024Quote: hMSC were plated at 15,000 cells/well in 24-well plates and grown overnight in a growth medium containing 10% FBS (Lonza). Once cells reached 80% confluency ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Biochemistry 2019Quote: ... 3×107 cells were transfected with 10 μg of NotI linearized plasmids using the AMAXA electroporator (Lonza, program X-001) as described [14] ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2020Quote: ... The MycoAlert Mycoplasma Detection Kit (Lonza) was used to monitor mycoplasma contamination on a regular basis.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... MycoAlert Mycoplasma Detection Kit (Lonza, Bioscience). Each cell lines were used within passage 4/5 since their thawing from originally frozen vials.
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing (MycoAlert Detection Kit, Lonza) was performed monthly.
-
bioRxiv - Cell Biology 2022Quote: ... using MycoAlert detection kit (Lonza, LT07). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... Regular testing with MycoAlert kit (Lonza) confirmed the absence of mycoplasma contamination ...
-
bioRxiv - Cancer Biology 2020Quote: ... using MycoAlert™ kit (Lonza, Germany) and genetically authenticated using a STR-PCR fragments kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... Kit T solution (Lonza, Basel, Switzerland), and programs G-016 ...
-
bioRxiv - Immunology 2021Quote: ... Nucleofector Kit V was from Lonza. The original vector pCasper-GR (#FP971 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with the SingleQuots kit (Lonza), 5 μg/ml transferrin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... Nucleofector Kit V (Lonza, VCA-1003); paraformaldehyde (Electron Microscopy Sciences ...