Labshake search
Citations for Lonza :
1 - 50 of 1213 citations for D Valine leucine arginine 4 methoxy 2 naphthylamine trifluoroacetate salt since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... or 4-D nucleofector (LONZA) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Cell Biology 2020Quote: Electroporation was performed using an Amaxa 4-D device (Lonza) or a Neon Transfection System (Thermo Fisher) ...
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... HMVECs-D were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 MV BulletKits™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were nucleofected with the 4-D Nucleofector System (Lonza, Cat#AAF-1003X) using the CA-137 program ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell/DNA mixture was then nucleofected using the 4-D nucleofector system (Lonza) code CB-150 and densely replated on Matrigel coated 6-well plates at 2.5×106 cells per well ...
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program EO-115 on a 4-D Nucleofector X unit (Lonza).
-
bioRxiv - Immunology 2023Quote: ... and primary T cells were electroporated using the P3 Primary Cell 4-D Kit (Lonza). For Cas9 and sgRNA delivery ...
-
bioRxiv - Bioengineering 2024Quote: ... and fibroblasts were nucleofected using a 4-D Nucleofector system and 96-well unit (Lonza). gRNAs were prepared by annealing crRNA and trcrRNA (IDT ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... 2.0 ml Hank’s balanced salt solution (HBSS, Lonza 10547F) supplemented with 2 mM CaCl2 (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... red phenol-free Hank’s Balanced Salt Solution (HBSS, Lonza) supplemented with HEPES (1mM ...
-
bioRxiv - Immunology 2024Quote: ... were suspended in Hanks balanced salt solution (HBSS) (Lonza) with 2% FBS and 20 mM HEPES (Hyclone ...
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated on a 2% or 4% agarose gel (Seakem LE agarose, Lonza #50004) by electrophoresis (120 V ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 x 105 cells were resuspended in 100uL of P2 medium (Lonza) containing 10 µg of Cas9 or Cas9/guide plasmidic DNA and transferred to a cuvette (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HPAECs were cultured for 4 hours in endothelial basal medium (EBM-2, Lonza) with 2% FBS ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Immunology 2022Quote: ... for 4 days with complete EGM-2 media (Lonza CC-4147, Lonza CC-3156). Upon reaching 80-90% confluence ...
-
bioRxiv - Immunology 2022Quote: ... for 4 days with complete EGM-2 media (Lonza CC-4147, Lonza CC-3156). Upon reaching 80-90% confluence ...
-
bioRxiv - Immunology 2022Quote: ... puromycin containing medium were changed and every 4 days cells were fed EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were seeded at 2×106 per 6cm plate in 4 mL S2 medium (Lonza). One hour after plating ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Cell Biology 2021Quote: ... Intoxications and washes were carried in Hanks’ balanced salt solution (HBSS, Lonza). The following antibodies were used at 1/200 for immunofluorescence microscopy (IF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and cells were washed with Hank’s Balance Salt Solution (HBSS) (Lonza, Switzerland) before cells were loaded with 10μM Fluo-4/AM (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffered saline solution (CC-5024, Lonza) before renewing the medium or passaging the cells ...
-
bioRxiv - Microbiology 2021Quote: Mouse femurs were removed and flushed with Hank’s Buffered Salt Solution (HBSS-Lonza) as described [23] ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 x 105 cells*ml) in 2 ml of Insect-Xpress medium (Lonza; Cat#BE12-730P10) were transfected with recombinant bacmids using Cellfectin II reagent (Gibco-Thermo Fisher Scientific™ ...