Labshake search
Citations for Lonza :
1 - 50 of 834 citations for D Iditol 1 13C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... or 4-D nucleofector (LONZA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Pre-warmed D-PBS (Lonza) was added to the apical side of the insert 5min prior to TEER measurement ...
-
bioRxiv - Cell Biology 2021Quote: ... at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP, Lonza, Cat. No. D-00059) using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... D Drucker) were routinely cultured in Dulbecco’s modified eagle medium (DMEM) (5.5 mmol/L D-glucose) (Lonza, UK), supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Cell Biology 2020Quote: ... human dermal microvascular endothelial cells (HMVECs-D) (Lonza) or human brain microvascular Endothelial Cells (HBMECs ...
-
bioRxiv - Immunology 2020Quote: ... resuspended in endotoxin-free PBS (D-PBS Lonza), counted under dark field microscopy using a Petroff-Hauser chamber and diluted to the appropriate concentration ...
-
bioRxiv - Cell Biology 2020Quote: Electroporation was performed using an Amaxa 4-D device (Lonza) or a Neon Transfection System (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: SV40LT-immortalized MEFs were grown in D-MEM (Lonza, BE12-614F) supplemented with 10% fetal bovine serum (EuroClone ...
-
bioRxiv - Molecular Biology 2020Quote: ... HeLa 1.3 cells were grown in D-MEM (Lonza, BE12-614F) supplemented with 10% fetal bovine serum (EuroClone ...
-
bioRxiv - Immunology 2023Quote: ... PmaxTM GFP expression vector was acquired from Lonza (cat numb #D-00061). Expression plasmid for ZIKV NS5 was generated by amplifying the NS5 coding sequence (amino acids 2521-3423 in the polyprotein ...
-
bioRxiv - Bioengineering 2023Quote: ... Adult human dermal microvascular endothelial cells (HMVEC-d) (LONZA, Cat# CC-2543) (passage 8 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were nucleofected with the 4-D Nucleofector System (Lonza, Cat#AAF-1003X) using the CA-137 program ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell/DNA mixture was then nucleofected using the 4-D nucleofector system (Lonza) code CB-150 and densely replated on Matrigel coated 6-well plates at 2.5×106 cells per well ...
-
bioRxiv - Bioengineering 2021Quote: T47-D human breast cancer cell line was cultured in RPMI-1640 (Lonza, Switzerland) supplemented by 10% FBS (EuroClone ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was aspirated and cells were resuspended in 15 μL buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated in the RNP mix ...
-
bioRxiv - Microbiology 2024Quote: Primary human dermal microvascular endothelial cells (hMVEC-d) were purchased from Lonza (CC-2543), grown in EBM (CC-3156 ...
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program EO-115 on a 4-D Nucleofector X unit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... and plated on poly-D-lysine coated flasks with astrocyte growth media (Lonza, Basel, Switzerland), changing the media every 3 days ...
-
bioRxiv - Immunology 2023Quote: ... and primary T cells were electroporated using the P3 Primary Cell 4-D Kit (Lonza). For Cas9 and sgRNA delivery ...
-
bioRxiv - Bioengineering 2024Quote: ... and fibroblasts were nucleofected using a 4-D Nucleofector system and 96-well unit (Lonza). gRNAs were prepared by annealing crRNA and trcrRNA (IDT ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Bioengineering 2024Quote: ... and seeded with human pulmonary artery endothelial cells in rectangular channel experiments (HPAEC, Lonza, Fig.1A-D), or human umbilical vein endothelial cells in round channel experiments (HUVEC ...
-
bioRxiv - Cell Biology 2024Quote: ... and it contains Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were passaged in poly-D-Lysine treated plates and incubated overnight in OPTI-MEM medium (Lonza) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... STD-M (−) consisted of Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2020Quote: ... HMVECs-D were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 MV BulletKits™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 50 mM D-mannitol] modified from a previous report,86 and electroporation was performed by a Nucleofector 2b device (Lonza Bioscience). Cells were transfected with siRNAs twice with a 48-h interval ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... in F12 : DMEM (1 : 1) (Lonza, UK). Following digestion the suspension was passed through sterile gauze and a 70 µm cell strainer before centrifugation at 350 g for 10 minutes ...