Labshake search
Citations for Lonza :
51 - 100 of 2639 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... one plate was prepared with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Immunology 2022Quote: ... were cultured in EBM-2 supplemented with EGM-2 endothelial growth SingleQuot kit supplement & growth factors (Lonza, the Netherlands). All of the cell lines used in this study tested negative for the presence of Mycoplasma spp ...
-
bioRxiv - Developmental Biology 2020Quote: ... HLECs were grown on culture dishes or glass slide coated with 0.2% gelatin and were maintained in EGM-2 EC Growth Medium-2 Bullet Kit (Lonza). All experiments were conducted using cells until passage (P ...
-
bioRxiv - Bioengineering 2019Quote: ... Chip medium was prepared by adding EGM-2 SingleQuot bullet kit (Lonza) to DMEM/F12 (Lifesciences) ...
-
bioRxiv - Biophysics 2021Quote: ... with the addition of EGM-2 MV Bullet Kit (Lonza CC-4147), with the exception of gentamicin ...
-
bioRxiv - Cancer Biology 2019Quote: ... HUVECs were cultured with EGM-2 bullet kit media (#cc-3162, Lonza) with 1X antibiotic-antimycotic (#15240062 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and grown in Endothelial Medium Bullet Kit (EGM-2, Lonza, CC-3162). For viral production ...
-
bioRxiv - Microbiology 2022Quote: Transfection was performed using the Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine in their drinking water ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection experiments were performed using Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine ...
-
bioRxiv - Cell Biology 2023Quote: ... with EGM-2 SingleQuots supplement kit (CC-4176, Lonza Clonetics, Fisher scientific). All experiments were performed using low-passage cells (passage 3-8) ...
-
bioRxiv - Bioengineering 2021Quote: ... Each chamber was connected to a reservoir that was pre-filled with 15 mL of warm serum-free EGM-2 (endothelial cell growth medium-2 without serum added from the kit, Lonza). ECFCs were harvested and resuspended in serum-free EGM-2 and added to the reservoirs to reach an overall cell density of 125,000 cells/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... Both endothelial cell lines (HUVEC, hPAEC) were grown in EBM-2 media with EGM-2 bullet kit (purchased from Lonza). No additional serum was used for cell culture ...
-
bioRxiv - Biophysics 2022Quote: ... CD146 positive cells were retained in the column and flushed with 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza) into a separate tube ...
-
bioRxiv - Physiology 2024Quote: ... Endothelial cells were grown in endothelial cell basal medium (EBM-2) supplemented with an endothelial cell bullet kit (EGM-2) (Lonza) and used between passage 3 and 5 in tissue culture dishes coated with 0.1% gelatin and maintained at 37°C in a humidified incubator at 5% CO2 ...
-
bioRxiv - Biophysics 2023Quote: ... Any CD146 positive cells were eluted from the column using 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza). The cells were pelleted with a 300 g spin for 5 min and counted in 1 mL EGM-2 media ...
-
bioRxiv - Cell Biology 2020Quote: ... aliquots of obtained BM aspirates were seeded into cell culture flasks containing endothelial basal media (EBM-2, Lonza, Cologne, Germany) supplemented with 10% human platelet lysate (PL ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... pH 7.4 and grown in supplemented keratinocyte growth medium containing 0.15 mM CaCl2 (KBM-2 BulletKit, Lonza Biosciences, Basel, Switzerland) as previously described (38) ...
-
bioRxiv - Bioengineering 2022Quote: ... 30 µl was mixed with 6 µl 6X gel loading dye and run on a 50 ml gel containing 2% SeaKem Agarose (Lonza), 1x Tris-Acetate-EDTA (Boston BioProducts) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Microbiology 2019Quote: ... the antibody-virus mixture was aspirated and Vero cells were washed with PBS and overlaid with DMEM containing 2% heat-inactivated FBS and 1% SeaPlaque Agarose (Lonza, 50501). After 4–6 days ...
-
bioRxiv - Genomics 2021Quote: ... The medium was changed to fresh fibroblast medium containing β-mercaptoethanol on day 2 and to a defined hepatocyte growth medium (HCM, Lonza) on day On day 6 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Subset Four (podoplanin+CD36+) were sorted into 5mL FACS tubes containing endothelial basal media (EGM-2 medium without supplements added, Lonza, USA) supplemented with 10% FBS at 4°C degrees ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162; Lonza)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from Lonza and were cultured in EGM-2 SingleQuot Kit media (Lonza, cat #CC-3162) and used at passage 2-10 ...
-
bioRxiv - Physiology 2023Quote: ... Switzerland) and supplemented with Microvascular Endothelial Cell Growth Medium-2 Bullet Kit (Lonza).
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg of pX330 neomycin-resistant vector containing each gRNA and 10 mM ssODN were co-transfected into 2 × 106 ESCs using a Nucleofector (Lonza, program A023). Cells were plated onto two 10 cm dishes containing hygromycin-resistant DR4 MEFs ...
-
bioRxiv - Immunology 2023Quote: ... 80 µl of supernatant was removed and replenished with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified coding gene fragments of heavy-chain variable domains were separated on a 1.5% low-temperature melting agarose gel (Lonza Group AG, Basel, Switzerland). Approximately 700 base pair bands corresponding to the heavy-chain only immunoglobulin were extracted (QIAquick Gel Extraction Kit ...
-
bioRxiv - Genetics 2021Quote: ... The cells were electroporated by using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... We used the Human Stem Cell Nucleofector Kit 2 (Lonza, catalog no. LONVPH-5022). After electroporation ...
-
bioRxiv - Neuroscience 2023Quote: ... were cultured in an endothelial growth medium bullet kit (EGM- 2; Lonza, Basel, Switzerland) and used for experiments between passages three and seven ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
bioRxiv - Biochemistry 2019Quote: ... Sf21 cells (2 × 106 cells mL−1) were infected with the P3 viral stock in Insect-XPRESS protein-free medium (Lonza). The infected insect cells were grown at 27 °C with shaking for 66 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Conditioned media (containing EVs) was removed and the cells washed x 2 with PBS before trypsinisation using 1 × Trypsin-EDTA (Lonza, UK cat: T3924). Cell counts and viability were checked at the time of EV harvest using the trypan blue exclusion assay (0.4% Trypan blue solution ...
-
bioRxiv - Immunology 2020Quote: ... followed by washing in complete media (RPMI-1640 containing 10% FBS, 2 mM glutamine, 100 IU/ml penicillin, and 100 µg/ml streptomycin, Lonza, Walkersville, MD, USA). Isolated BAL cells (approx.1-2 x106 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were nucleofected using the Human Stem Cell Nucleofector® Kit 2 (Lonza, VPH-5022) in combination with the AMAXA-2b nucleofector ...
-
bioRxiv - Pathology 2020Quote: ... The purity of the final recombinant proteins was determined to be more than 99% by sodium dodecyl sulfate and polyacrylamide gel (SDS-PAGE) with an endotoxin concentration lower than 2 units/mg protein measured by Limulus Amebocyte Lysate PYROGENT™ 125 Plus (Lonza). In previous experiments we demonstrated that these recombinant proteins were functionally devoid of significant endotoxin contamination ...
-
bioRxiv - Genomics 2020Quote: ... containing 4uL 1X PBS (Lonza). The plates were centrifuged and immediately placed on dry ice ...
-
bioRxiv - Microbiology 2021Quote: ... containing 25 mM HEPES (Lonza), 2% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2022Quote: ... containing 1% Pen-Strep (Lonza). Cells were thawed in medium supplemented with 10% FBS (Sigma Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 10% FBS (Lonza, Switzerland) and 1X PenStrep (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... containing Neural Survival Factor (Lonza), N2 supplement (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... containing 5uL of 1XPBS (Lonza) per well using stringent precautions against contamination [22] ...