Labshake search
Citations for Lonza :
501 - 550 of 1997 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cell Biology 2022Quote: ... was induced in hVECs and pVECs on a 12-well plate using EGM™-2 MV Microvascular Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, #CC-3202), without VEGF ...
-
bioRxiv - Cell Biology 2019Quote: 4D-Nucleofector® X Kit (product V4XC-1032, Lonza)
-
bioRxiv - Molecular Biology 2019Quote: ... Amaxa Nucleofector™ Kits for Human Stem Cells (Lonza) was used according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-118) were used to ensure that all the cells used in this study were mycoplasma-free.
-
bioRxiv - Cancer Biology 2020Quote: ... biannually by MycoAlert Mycoplasma Detection Kit (LONZA; Verviers, Belgium).
-
bioRxiv - Cancer Biology 2020Quote: ... with the Cell Line Nucleofector® Kit V (Lonza) were used ...
-
bioRxiv - Genetics 2021Quote: ... REGM Renal Epithelial Cell Growth Medium SingleQuots Kit (Lonza), amphotericin B and P/S ...
-
bioRxiv - Immunology 2020Quote: ... and the SE cell line kit (Lonza, #V4XC-1024). The day before transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and P3 Primary Cell 4D-Nucleofector Kit S (Lonza) with the CA173 program ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amaxa Cell Line Nucleofector Kit V (VCA-1003, Lonza), Precision Red Advanced Protein Assay (ADV02-A ...
-
bioRxiv - Cell Biology 2022Quote: ... with necessary supplements (MSCGM hMSC SingleQuot Kit) (Lonza, UK). According to the manufacturer ...
-
bioRxiv - Neuroscience 2020Quote: ... with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza) using program DC154 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were grown in EGM-2 SingleQuot Kit media (Lonza) and used at passage 4-6 ...
-
bioRxiv - Bioengineering 2021Quote: ... The SF Cell Line 4D X Kit S (Lonza) was used for K562s and the P3 Primary Cell 4D Kit (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... using Amexa Cell line kit V (Lonza; VACA-1003), following a pre-existing protocol101 ...
-
bioRxiv - Cancer Biology 2022Quote: ... with Cell Line NucleofectorTM Kit V (Lonza, VCA-1003) and program T-020 ...
-
bioRxiv - Cancer Biology 2022Quote: Mycoplasma contamination was tested using the kit MycoAlertTM (Lonza). Cells were not authenticated in-house.
-
bioRxiv - Genomics 2019Quote: ... and Human T cell NucleofectorTM Kit (Lonza, VPA-1002), and the electroporation program was T-024 ...
-
bioRxiv - Cell Biology 2020Quote: ... pmaxGFP (purchased from Lonza, Human MSC Nucleofector® Kit) was used to control transfection efficiency ...
-
bioRxiv - Cell Biology 2021Quote: ... or the Amaxa Cell Line Nucleofector Kit V (Lonza VCA- 1003 ...
-
bioRxiv - Cell Biology 2021Quote: ... using the MycoAlert™ Mycoplasma Detection Kit (Lonza, Switzerland), as per manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... using the P3 Primary Cell 4D-Nucleofector Kit (Lonza) and the EO-100 program51,52 ...
-
bioRxiv - Immunology 2020Quote: ... using the Amaxa Human T Cell Nucleofector Kit (Lonza) and the Nucleofector 2b Device (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... Renal Cell Growth Medium (REGM) SingleQuot kit supplements (Lonza), 2.5μg/ml amphotericin B ...
-
bioRxiv - Cancer Biology 2022Quote: ... SF Cell Line 4D-Nucleofector™ x Kit (Lonza) were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were routinely tested (MycoAlert Detection Kit, Lonza) and confirmed to be free of mycoplasma contamination.
-
bioRxiv - Molecular Biology 2022Quote: ... and P3 primary kit (Lonza, catalog no. V4XP-3024) as per manufacturer’s instructions and plated out on matrigel coated 6-well plate using mTeSR with CloneR supplement ...
-
bioRxiv - Microbiology 2022Quote: ... and the P3 primary cells kit (Lonza; V4XP-3024) as previously described (81 ...
-
bioRxiv - Developmental Biology 2023Quote: ... using P3 Primary Cell 4D-Nucleofector X kit (Lonza). Transfected cells were plated onto irradiated DR4 MEFs (the Cell Bank of the Chinese Academy of Sciences ...
-
bioRxiv - Developmental Biology 2023Quote: ... using P3 Primary Cell 4D-Nucleofector X kit (Lonza). Transfected cells were plated onto irradiated DR4 MEFs (the Cell Bank of the Chinese Academy of Sciences ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using RBL-specific Amaxa Nucleofector transfection kit T (Lonza). Some samples ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using RBL-specific Amaxa Nucleofector transfection kit T (Lonza). In this experiment ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza). MDA-MB-231 cells were maintained in RPMI 1640 media supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with the EGM-2 MV SingleQuots kit (Lonza). For culturing of primary lymphocytes ...
-
bioRxiv - Biochemistry 2023Quote: ... MCF-10A [MEBM supplemented with Kit CC-3150 (Lonza) and 100 ng/mL cholera toxin (Sigma)] ...
-
bioRxiv - Cell Biology 2023Quote: — MycoAlert Mycoplasma Detection Kit (Lonza cat. no. LT07-118)
-
bioRxiv - Cancer Biology 2023Quote: ... with an SF kit (Catalog: V4CX-2032, Lonza Biosciences) as per manufacturer instructions using pulse code CM-120 ...
-
bioRxiv - Cell Biology 2023Quote: ... using the MycoAlert™ Detection Kit (Lonza, #LT07-418) and MycoAlert™ Control Set (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were mycoplasma negative (MycoAlert kit, Lonza). Experiments were performed using charcoal-stripped serum (CTS) ...
-
bioRxiv - Cell Biology 2023Quote: ... in combination with Nucleofector Kit V (Lonza, VCA-1003) according to the manufacturer’s recommended protocol.