Labshake search
Citations for Lonza :
101 - 150 of 2513 citations for 8 11 Methano 10a 3 6a 1 propanyl 3 ylidene 8H indeno 2 1 b azocine 12 14 dione 5 acetyloxy 4 benzoyloxy dodecahydro 1 3 dimethyl 9 methylene 3R 4S 5R 6aR 6bR 8S 10aR 11R 11aS 15S 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... a 3 ml of DMEM containing 0.5% SeaKem ME agarose (Lonza), 5% (v/v ...
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were size-selected using 3% NuSieve agarose gels (Lonza) followed by gel extraction using QIAEX II reagents (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Neuroscience 2021Quote: ... The behavioral assay consisted of a 3% agarose (SeaKem LE Agarose, Lonza) surface coating (50 mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... as previously described (3) and the Cell Line Nucleofector Kit R (Lonza). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... pelleted an incubated for 3’ with ACK lysis buffer(10-548E, Lonza) to remove red blood cells ...
-
bioRxiv - Immunology 2022Quote: ... After 3 days cells were harvested and resuspended in P3 buffer (Lonza), mixed with RNP complexes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the resulting PCR products were analyzed on a 3 % MetaPhorTM (Lonza) agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3×106 viable cells were resuspended in P3 Primary Cell solution (Lonza), mixed with 2 µM control or 2 µM target-specific ASO and transferred to nucleocuvettes for nucleofection on a 4D-Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Human Umbilical Venous Endothelial Cells (HUVEC; pooled from 3 individual donors; LONZA) were starved for 6 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were separated by gel electrophoresis using a 3% MetaPhor agarose (Lonza) using standard techniques ...
-
bioRxiv - Biophysics 2023Quote: ... After rinsing 3 times with phosphate buffered saline (PBS, 17-517Q, Lonza), cells were stained with Hoechst 33342 in imaging medium for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: IMCD-3 cells were cultured with DMEM:F12 (Lonza, cat. No. BE12-719F), fetal bovine serum was added to a final concentration of 10% and penicicillin/streptomycin (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA samples were loaded on 3% NusieveTM GTGTM Agarose gel (Lonza, 50081), and electrophoresis was run at 100V in 1X TBE buffer for ∼50 min ...
-
bioRxiv - Systems Biology 2019Quote: ... and 1% penicillin-streptomycin-amphotericin B solution (Lonza, Walkersville, MD, USA). Cells were grown on Matrigel (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... All media contained 1% Penicillin-Streptomycin-Amphotericin B mixture (Lonza, Switzerland) as well ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% NEAA and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). For feeder-free culture ...
-
bioRxiv - Biophysics 2022Quote: ... 1 ml Penicillin-Streptomycin-Amphotericin B Mixture (PSF, Lonza 17-745E)) ...
-
bioRxiv - Microbiology 2022Quote: HNE1 cells were cultured in 1:1 mixture of Dulbecco modified Eagle medium (DMEM; Lonza; 12-604Q) and Ham’s F-12 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... supplemented with Ultraglutamine-1 (4 mM; Lonza) and antibiotic-antimycotic (1% ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1-μg/mL αCD28) in X-VIVO 15 (Lonza). T cells (2.5 × 105 ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Cell Biology 2020Quote: ... 8 and 14 of culture with 70 µL of BEGM** (Lonza). On day 21 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5 U ml−1 Penstrep (Lonza). Hb9-GFP mouse stem cells were cultured as described (Wichterle et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U ml−1 Penicillin-streptomycin (Lonza) and 5 mM sodium pyruvate ...
-
bioRxiv - Bioengineering 2023Quote: ... MCF-10A cells were cultured using an MEGM™ Mammary Epithelial Cell Growth Medium BulletKit™ without gentamycin-amphotericin B mix (Lonza) following ATCC’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... while HO-1-N-1 (JCRB0831) cells were cultured in DMEM/F-12 (Dulbecco’s Modified Eagle Medium:F12; Lonza) medium ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified DNA was separated on a 3% NuSieve GTG agarose gel (Lonza #50081). The gel band corresponding to the size of dinucleosomal DNA (∼250 to 350 bp ...
-
bioRxiv - Genomics 2020Quote: ... Purified DNA was separated on a 3% NuSieve GTG agarose gel (Lonza #50081). The gel band corresponding to the size of dinucleosomal DNA (∼250 to 350bp ...
-
bioRxiv - Bioengineering 2021Quote: ... Erythrocytes were lysed for 3 min on ice in ACK lysing buffer (Lonza), stained with biotinylated lineage antibodies against CD3ε (145-2C11) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Molecular Biology 2023Quote: ... 1×105 cells were grown in each well of 12 well culture plates in SkGM-2 BulletKit growth medium (Lonza) to >90% confluency under standard culture conditions of 37°C and 5% CO2 ...
-
bioRxiv - Genomics 2023Quote: ... Both vectors were also transfected as background controls (1 µg) with pmaxGFP (9 µg, Lonza). 24 hours post nucleofection ...
-
bioRxiv - Immunology 2020Quote: ... diluted 1:100 in EBM-2 (Lonza). Cells were used for experiments within 3-5 passages ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg ml−1 streptomycin and 15 ng ml−1 recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Immunology 2019Quote: ... B cells were cultured for 2 to 4 days in RPMI 1640 with UltraGlutamine (Lonza) containing 10% fetal calf serum (FCS ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Cancer Biology 2022Quote: ... MCF-10A was cultured with MEBM medium (Lonza, Switzerland) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... MCF-10A [MEBM supplemented with Kit CC-3150 (Lonza) and 100 ng/mL cholera toxin (Sigma)] ...